ID: 1097281113

View in Genome Browser
Species Human (GRCh38)
Location 12:57846011-57846033
Sequence CTTTCCTTCACCGCCGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097281113_1097281115 4 Left 1097281113 12:57846011-57846033 CCGCGCGCGGCGGTGAAGGAAAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1097281115 12:57846038-57846060 GACCCCACCCCCAACTCCGGAGG 0: 1
1: 0
2: 2
3: 33
4: 284
1097281113_1097281114 1 Left 1097281113 12:57846011-57846033 CCGCGCGCGGCGGTGAAGGAAAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1097281114 12:57846035-57846057 GACGACCCCACCCCCAACTCCGG 0: 1
1: 1
2: 2
3: 10
4: 229
1097281113_1097281120 10 Left 1097281113 12:57846011-57846033 CCGCGCGCGGCGGTGAAGGAAAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1097281120 12:57846044-57846066 ACCCCCAACTCCGGAGGCGGTGG 0: 1
1: 0
2: 0
3: 27
4: 583
1097281113_1097281127 21 Left 1097281113 12:57846011-57846033 CCGCGCGCGGCGGTGAAGGAAAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1097281127 12:57846055-57846077 CGGAGGCGGTGGACGCGGAGTGG 0: 1
1: 0
2: 2
3: 33
4: 358
1097281113_1097281118 7 Left 1097281113 12:57846011-57846033 CCGCGCGCGGCGGTGAAGGAAAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1097281118 12:57846041-57846063 CCCACCCCCAACTCCGGAGGCGG 0: 1
1: 0
2: 2
3: 34
4: 268
1097281113_1097281125 16 Left 1097281113 12:57846011-57846033 CCGCGCGCGGCGGTGAAGGAAAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1097281125 12:57846050-57846072 AACTCCGGAGGCGGTGGACGCGG 0: 1
1: 0
2: 0
3: 18
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097281113 Original CRISPR CTTTCCTTCACCGCCGCGCG CGG (reversed) Intronic