ID: 1097281951

View in Genome Browser
Species Human (GRCh38)
Location 12:57850451-57850473
Sequence TATTTTAGGCAGAAGTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 253}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097281951_1097281956 6 Left 1097281951 12:57850451-57850473 CCTTCTAACTTCTGCCTAAAATA 0: 1
1: 0
2: 4
3: 18
4: 253
Right 1097281956 12:57850480-57850502 AAAATAACATCCTGCCTACGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1097281951_1097281958 12 Left 1097281951 12:57850451-57850473 CCTTCTAACTTCTGCCTAAAATA 0: 1
1: 0
2: 4
3: 18
4: 253
Right 1097281958 12:57850486-57850508 ACATCCTGCCTACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 108
1097281951_1097281955 5 Left 1097281951 12:57850451-57850473 CCTTCTAACTTCTGCCTAAAATA 0: 1
1: 0
2: 4
3: 18
4: 253
Right 1097281955 12:57850479-57850501 AAAAATAACATCCTGCCTACGGG 0: 1
1: 0
2: 1
3: 20
4: 212
1097281951_1097281961 23 Left 1097281951 12:57850451-57850473 CCTTCTAACTTCTGCCTAAAATA 0: 1
1: 0
2: 4
3: 18
4: 253
Right 1097281961 12:57850497-57850519 ACGGGGCCTGGGCCAGTTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 239
1097281951_1097281954 4 Left 1097281951 12:57850451-57850473 CCTTCTAACTTCTGCCTAAAATA 0: 1
1: 0
2: 4
3: 18
4: 253
Right 1097281954 12:57850478-57850500 CAAAAATAACATCCTGCCTACGG 0: 1
1: 0
2: 0
3: 10
4: 168
1097281951_1097281957 11 Left 1097281951 12:57850451-57850473 CCTTCTAACTTCTGCCTAAAATA 0: 1
1: 0
2: 4
3: 18
4: 253
Right 1097281957 12:57850485-57850507 AACATCCTGCCTACGGGGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097281951 Original CRISPR TATTTTAGGCAGAAGTTAGA AGG (reversed) Intergenic
902176044 1:14651864-14651886 TATTATGTGAAGAAGTTAGAAGG - Intronic
902189410 1:14751396-14751418 TATGTTAGCTACAAGTTAGATGG - Intronic
905596950 1:39215751-39215773 TATTTTTAGCAGAAGTTGGTTGG + Intronic
910418222 1:87024749-87024771 TTTTTTAGGTAGAAGGTATATGG + Intronic
911013955 1:93312044-93312066 TCTTTTAGGCAGAATATAGTTGG - Intergenic
911569308 1:99503770-99503792 TATTTTTAACTGAAGTTAGAGGG + Intergenic
911686452 1:100782208-100782230 CAATTTAAGCAGAATTTAGAAGG - Intergenic
912856621 1:113174185-113174207 TCTTTTAGGCAGCATTTAGTTGG - Intergenic
914324176 1:146595336-146595358 TGTTATAGGAAGAAGTGAGAGGG - Intergenic
916273913 1:162972846-162972868 CCTTTTCAGCAGAAGTTAGAGGG + Intergenic
916659894 1:166913641-166913663 GATTTTAGGTAGAACTAAGAGGG - Exonic
919481948 1:198100956-198100978 TATTTTAGACATAAGTTATATGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921428966 1:215041054-215041076 TAATTTAGCCAGAAATAAGATGG - Intronic
1065983423 10:30926189-30926211 TATTTTGGGTAGTAGTTACACGG + Intronic
1066322719 10:34320516-34320538 TAGTTTTGGCAGAAGTTCAAGGG + Intronic
1066349793 10:34626796-34626818 TATCTTTGGCTGCAGTTAGAAGG - Intronic
1068762333 10:60726315-60726337 TGTTTTAGGCAGAAATTAGATGG - Intronic
1069100525 10:64314828-64314850 AATTTAAGGCAAAAGATAGAAGG - Intergenic
1071745278 10:88411776-88411798 TGTTTTGGGAAGAAGTAAGAAGG + Intronic
1072228649 10:93394050-93394072 TATTTTAAGCAAATGGTAGAAGG - Intronic
1073840018 10:107487825-107487847 TATTTTAAGCAGATGTGAGCTGG - Intergenic
1077638264 11:3858170-3858192 TATTTTAGACATAAGCTAAAGGG + Intronic
1077770200 11:5209830-5209852 TATTATAGCCAAAAGCTAGAAGG - Intergenic
1079385559 11:19976300-19976322 TATTTCAAGCAGCAGGTAGATGG + Intronic
1081714426 11:45238440-45238462 TGTTTTATGCACAAGATAGAAGG + Intergenic
1082641704 11:55669096-55669118 TATTTTAGGCAGCAGTGAAAAGG - Intergenic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1084469311 11:69346810-69346832 TATTTTTGGCAGAAGTGCCATGG - Intronic
1085707163 11:78796718-78796740 TATTTGTGGCAGTAGTGAGAGGG - Intronic
1090908920 11:131101380-131101402 TAGTTTAGGCAGAAGCCAGGAGG + Intergenic
1093723044 12:22467710-22467732 CATTTTAGGGAGAATTGAGAGGG - Intronic
1095559394 12:43547757-43547779 TATTATAGCCAGAATTCAGAGGG + Intronic
1097281951 12:57850451-57850473 TATTTTAGGCAGAAGTTAGAAGG - Intergenic
1097349588 12:58533921-58533943 TATATTAGACAGAAGTTATAGGG + Intergenic
1097372467 12:58801206-58801228 TATCTTAGGAACAAGTAAGATGG - Intronic
1098786550 12:74765291-74765313 TTTTTTAATCAGAGGTTAGATGG - Intergenic
1098812884 12:75118605-75118627 GTTTTTAGGAAGAAGTCAGAAGG + Intronic
1100198169 12:92270968-92270990 TAGTTAAGGCAGAAGGCAGAAGG + Intergenic
1100336490 12:93635414-93635436 TATTTTAGGTACATTTTAGAAGG - Intergenic
1100560846 12:95748405-95748427 TATATTAGGCAAAAGTTCCAGGG - Intronic
1101009385 12:100433388-100433410 TATTATAGTCAGATGTTACATGG - Intergenic
1101192271 12:102347347-102347369 TATTCTAGGGAGAAATTTGAAGG + Intergenic
1102413246 12:112738540-112738562 CATTTTGAGCAGAATTTAGATGG + Intronic
1102436581 12:112929010-112929032 TAGATGAGGCAGGAGTTAGACGG - Intronic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1107740671 13:43446664-43446686 AAGGTTGGGCAGAAGTTAGATGG - Intronic
1108089838 13:46837480-46837502 TAATATGGGCAGGAGTTAGAAGG - Intronic
1108433784 13:50381267-50381289 TATTTTAGGAAGAAGGGAAATGG + Intronic
1108804519 13:54137928-54137950 CATTCCAGGCAGAAGTTATAGGG + Intergenic
1108948282 13:56051730-56051752 TATTTTAGGAAAAAATTATATGG - Intergenic
1109331805 13:60940263-60940285 GGTTTTATGCAGCAGTTAGAAGG + Intergenic
1112637318 13:101228998-101229020 TATGTTAGTCAGAATCTAGAAGG - Intronic
1112943424 13:104894394-104894416 TATTTTATACAGATGTTACAAGG - Intergenic
1114135876 14:19849628-19849650 TATTTTGGGAAGAAGTTATGGGG - Intergenic
1115930535 14:38487358-38487380 TACTGTTGGCAGAAGTTAAATGG + Intergenic
1116100863 14:40433625-40433647 TATATTAGGCTGAAATTAAATGG + Intergenic
1116142628 14:41018414-41018436 ACTTTTATCCAGAAGTTAGAAGG - Intergenic
1117657780 14:57974057-57974079 GAATTTAGGCAGGACTTAGACGG + Intronic
1117850932 14:59968620-59968642 TACTTTATGGAGAAGTAAGAAGG + Intronic
1119791355 14:77352794-77352816 TAAATTAGGCAGAACATAGAGGG + Intronic
1122260244 14:100514282-100514304 TATTTTAGGCAGCATATAGCTGG + Intronic
1122677541 14:103428493-103428515 TATTTAAGGGACAAATTAGATGG - Intronic
1124149649 15:27166136-27166158 TATTTTAGAAGGAAGTTGGATGG + Intronic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125096723 15:35862581-35862603 TATTTAAGACAGAGGATAGATGG - Intergenic
1126433393 15:48610588-48610610 TATTTTGGGCAGAACAGAGAAGG + Intronic
1126561748 15:50051716-50051738 TATTTTAGCTTTAAGTTAGAAGG - Intronic
1129492273 15:75939507-75939529 AATTTTTGGGAAAAGTTAGAAGG - Exonic
1131935976 15:97505348-97505370 TACCTGAGGCAGAAGTTAGTTGG - Intergenic
1132155460 15:99492653-99492675 TATTCTAAGCAGTATTTAGAAGG + Intergenic
1133719086 16:8477673-8477695 ATATTTAGGCAGAAGCTAGATGG + Intergenic
1133881722 16:9788610-9788632 TATATGAGGGAGAAATTAGAGGG - Intronic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1140009382 16:71115509-71115531 TGTTATAGGAAGAAGTGAGAGGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143442406 17:6985571-6985593 TATGTTAGGAAGATGATAGATGG + Intronic
1145092993 17:20001252-20001274 TAATAAAGGCAGAAGTTAAAGGG - Intergenic
1145377198 17:22361907-22361929 TATGTAAGTCAGTAGTTAGAAGG - Intergenic
1146767124 17:35533627-35533649 TTTTCTAGACAGAAGTAAGAAGG + Intronic
1148065196 17:44864108-44864130 TGTTTTAAGTAGATGTTAGATGG - Intronic
1148114238 17:45165714-45165736 TATTCCAGGCAGAAGTTGGTAGG - Intronic
1149628578 17:58099470-58099492 TGTTTGAGCCAGGAGTTAGAAGG - Intergenic
1153380467 18:4433460-4433482 TGTTTTTTGAAGAAGTTAGAGGG + Intronic
1153384811 18:4480188-4480210 TATCTTTGACAGAATTTAGAAGG + Intergenic
1153578276 18:6544813-6544835 TATTTTAAGAAGAAATTTGAAGG - Intronic
1153854019 18:9127197-9127219 ATTTTTAGGTAGAAATTAGAGGG - Intronic
1154344941 18:13534082-13534104 TTTTTGTGGCAGAAGTGAGAAGG - Intronic
1154459965 18:14573103-14573125 TATTTTGGGAAGAAGTTTTAGGG - Intergenic
1154962349 18:21322112-21322134 TATTATAAGCAGAATTCAGAAGG + Intronic
1158015477 18:52777864-52777886 TATCTATGGCAGAAGGTAGATGG + Intronic
1159307035 18:66656987-66657009 TAATTTAGGCATTAGTTATAAGG - Intergenic
1159315107 18:66762810-66762832 TATTTTAGGCATACATGAGAAGG + Intergenic
1159324618 18:66898381-66898403 TGTTTTATGCAGTTGTTAGATGG + Intergenic
1164090474 19:21947401-21947423 ATTTTTAGGCAAAAGTTAGAAGG - Intronic
1166558711 19:43718339-43718361 CATTTTTGGCACAAGTTAGAGGG - Intronic
925874564 2:8300967-8300989 TGTTTTAGGAAGGAGATAGATGG - Intergenic
926618351 2:15021949-15021971 AATTGTAGGCAGAAGGCAGAAGG + Intergenic
926674479 2:15609242-15609264 GATTATAGACAAAAGTTAGAGGG + Intronic
928227054 2:29459094-29459116 TTTTTAAGGCATATGTTAGATGG - Intronic
929080743 2:38119738-38119760 TATTTAGGGCAGAAGCTAAAAGG + Intergenic
930291141 2:49493693-49493715 TATTGTAGGCAGCACATAGATGG - Intergenic
930504068 2:52259443-52259465 TATTTGAAACACAAGTTAGATGG - Intergenic
931098897 2:58973356-58973378 TGCTTTAGGCAGAATTAAGATGG - Intergenic
931896535 2:66737094-66737116 TATTTTAGGAAGAAATTCTAAGG - Intergenic
933328586 2:80869244-80869266 CATTTTAAGAGGAAGTTAGAAGG + Intergenic
933944700 2:87275935-87275957 TATTTTGGGCAGAAGCTACCCGG + Intergenic
934960727 2:98670179-98670201 CCTTTTAGGCAGGAGTAAGATGG + Intronic
936335510 2:111585643-111585665 TATTTTGGGCAGAAGCTACCCGG - Intergenic
937544756 2:123003602-123003624 TATTTGAGGCAGAGATTAAAGGG + Intergenic
938695606 2:133832722-133832744 TATGTAAGGCAGAAGCAAGATGG - Intergenic
939557172 2:143689854-143689876 TATTGTAGGTAGAAGGCAGAAGG - Intronic
939656907 2:144837238-144837260 TCTTTTAGGCAGATTTTTGAAGG - Intergenic
939899852 2:147838694-147838716 TAGTTTTAGCAGAAGCTAGATGG - Intergenic
940558923 2:155268938-155268960 TATATTCTGCAGATGTTAGATGG - Intergenic
941269056 2:163402401-163402423 TATTTAAGGCTGAACTTAAATGG - Intergenic
941536156 2:166724161-166724183 TATTTTTGGCAGAATTTAAATGG + Intergenic
942291890 2:174481308-174481330 TATTTTAGGTAGATGTTTAAAGG + Intronic
942712616 2:178853892-178853914 TATTTTAGGCAAACCTAAGAAGG - Intronic
945801830 2:214442297-214442319 TCTTTTAGGCAGAAGTGAGAAGG + Intronic
946473417 2:219984185-219984207 TCTTCTAGGCACAAATTAGAAGG - Intergenic
946971066 2:225092389-225092411 ATTTTTAGGGAGAAGTTTGAAGG - Intergenic
946975477 2:225144235-225144257 TCTTTTAGGCAGAATATAGTTGG - Intergenic
947390240 2:229631426-229631448 TATTTTAAGAAGAAGCTGGAGGG - Intronic
948339477 2:237237957-237237979 TCCTTCAGGCAGAAGCTAGAAGG + Intergenic
1169076564 20:2763467-2763489 TCTTTTTGGAAGAAGTTAAAAGG - Intergenic
1169816909 20:9666600-9666622 CATTGTAGCCAGAAGTAAGAAGG - Intronic
1172490709 20:35335000-35335022 AATTTTAGACAGTAGTAAGAAGG - Intronic
1173340690 20:42150158-42150180 TATTTTAGGCATAACTCAGAAGG - Intronic
1174199278 20:48795686-48795708 AATGGTAGGCAGAAGTCAGAAGG + Intronic
1174654235 20:52156959-52156981 TTTTGTAAGCAGAATTTAGAGGG + Intronic
1174675776 20:52353106-52353128 TCTTGTAGGCAGAATTAAGATGG + Intergenic
1177356939 21:20020363-20020385 TATTTTAAGCAGAGCTGAGAAGG - Intergenic
1177466020 21:21481092-21481114 TATTTTAGGCATTGCTTAGACGG - Intronic
1181662728 22:24364749-24364771 TGTTTTTGGCTGAATTTAGAAGG + Intronic
949180822 3:1129261-1129283 TATTTTAAGTGCAAGTTAGAGGG + Intronic
949409290 3:3746313-3746335 TATTTTAGGAATAATATAGAAGG - Intronic
949587598 3:5457203-5457225 TACTTTTGGCAGAATTAAGATGG - Intergenic
949717879 3:6954465-6954487 TATTTTAGGGATATGTCAGAAGG - Intronic
950101080 3:10357398-10357420 CATTTTAGGCAGCAGGGAGAGGG - Intronic
950758786 3:15202133-15202155 AATTTTAGGAAGAAGTGAGTTGG - Intergenic
950964268 3:17135424-17135446 TATTTTAGCCAGTAGGAAGAAGG - Intergenic
952528293 3:34236899-34236921 TATTTCAGTGAGAAGATAGACGG + Intergenic
952728999 3:36619551-36619573 AATATCAGCCAGAAGTTAGAAGG - Intergenic
956039178 3:65128334-65128356 TCTTTTAGGCAGAAGTTATAAGG + Intergenic
956752977 3:72359611-72359633 TATTTTAAGCTGAAAATAGATGG + Intergenic
958760851 3:98306099-98306121 TTTTCTAGGCAAAAGTTAGGGGG - Intergenic
960050943 3:113238901-113238923 TGTTTTAGAAAGAAGGTAGATGG + Intronic
960200508 3:114829651-114829673 GATTCTAGGTAGAAGTTACACGG + Intronic
960351836 3:116603184-116603206 TGTTTTAGGTAGAAACTAGATGG - Intronic
961909434 3:130299798-130299820 TATTTTAATGAGAAGTTAGGAGG - Intergenic
963025542 3:140915227-140915249 TATTTTAAGTAGAATTTTGAAGG + Intergenic
963222803 3:142829337-142829359 TATTTTAGGTTGAAGTTCTAGGG - Intronic
963758043 3:149256614-149256636 TCTTTTAGGAAGAAATTAAAGGG + Intergenic
964174545 3:153810272-153810294 AATATAAGGCAGAAATTAGAGGG + Intergenic
965017512 3:163176771-163176793 TATTTTAGGTGGATGTTAGATGG + Intergenic
965130562 3:164693971-164693993 GAGTTTAGGCAGAACTCAGATGG - Intergenic
965991710 3:174826929-174826951 TAATTTAGGCTAAAGTTAGCTGG - Intronic
966140914 3:176754461-176754483 CATTTTAGGAAGAAAGTAGAAGG - Intergenic
966729035 3:183135139-183135161 AACTCAAGGCAGAAGTTAGAGGG + Intronic
972187024 4:36541800-36541822 TAAATCAGGCAGAAGTTGGAAGG - Intergenic
975493539 4:75014006-75014028 TAGATGAGCCAGAAGTTAGAGGG + Intronic
975883740 4:78940536-78940558 TATTCTGGGCTGAAGTGAGAGGG + Intergenic
977853923 4:101864918-101864940 TCTTTAAGGCAGAAGAGAGAAGG + Intronic
979002440 4:115241191-115241213 TTTTTAAGGAAGCAGTTAGAAGG - Intergenic
979287111 4:118938509-118938531 TATTGTAGGCAAAAGTCAGTAGG + Intronic
980421203 4:132563857-132563879 AATTTAAGGCAGAAGTAAAAAGG + Intergenic
982057805 4:151570269-151570291 TATTTCAGGCAGAAAGAAGAAGG - Intronic
983664941 4:170170885-170170907 TACTTTAGGGAGAGGTTAGAGGG + Intergenic
983693145 4:170497155-170497177 TATTTTAGGCTGAAGTGTGCGGG + Intergenic
984898490 4:184563500-184563522 TATTTAGGTCAGCAGTTAGAAGG - Intergenic
985168043 4:187118129-187118151 TATGTTAGGCCAAAGTTAGATGG - Intergenic
986665812 5:10103228-10103250 TATTTTAGGCGGAAGTTCCCGGG + Intergenic
986792602 5:11177725-11177747 TATATTATTCAGAATTTAGATGG - Intronic
987843886 5:23256600-23256622 CATTTTTGGCAGAAGGCAGAAGG - Intergenic
988262380 5:28904891-28904913 CATTTTAGGCAGGTGTTAGAGGG + Intergenic
988990614 5:36666945-36666967 TATTTTAGGCAGTAATCACATGG - Intronic
989392632 5:40917695-40917717 TATTTTAAATAGAAGTTTGAAGG - Intronic
989484516 5:41973865-41973887 TTTTTCAGGCAGAAGTTTAATGG - Intergenic
989545694 5:42670452-42670474 TAATCTAGGCAGAAGTTTCATGG + Intronic
989699235 5:44241786-44241808 AATTGTAGTCAGAATTTAGAAGG - Intergenic
993093454 5:83455324-83455346 TATTTTAGGCAGCATATAGGTGG - Intergenic
993370125 5:87082982-87083004 AATTTTATGAAGAAGATAGAAGG - Intergenic
993987991 5:94619533-94619555 TATTTGACTCAGGAGTTAGATGG + Intronic
993996175 5:94726149-94726171 AAATTGAGGCAGAAGTTTGAGGG - Intronic
994789390 5:104205055-104205077 TGTTTTAGCCATGAGTTAGATGG + Intergenic
996210747 5:120806359-120806381 TATTTTAAGCAGCAGCCAGATGG - Intergenic
996392990 5:122983421-122983443 TATTTTATGCAGATGGTATATGG - Intronic
997800490 5:136856035-136856057 TATTTTAAGCAGTAGGTAAAAGG + Intergenic
1000286963 5:159835078-159835100 TATTCTAGGCAGAAGTTTAGAGG - Intergenic
1003020929 6:2508827-2508849 TATTTTGGGGAGAAGGAAGAGGG + Intergenic
1004727623 6:18326383-18326405 TATTTTAGGCAGTATGGAGAAGG - Intergenic
1004864696 6:19840826-19840848 TACTTTACACACAAGTTAGATGG + Intergenic
1005188978 6:23196407-23196429 TATTTATGGCAGAAGGTAAAAGG - Intergenic
1005192675 6:23243645-23243667 TCCTTGAGGCAAAAGTTAGAAGG - Intergenic
1005508441 6:26490828-26490850 TAATTTAGGCAGGTGTTGGAAGG - Intergenic
1006573993 6:35030229-35030251 TATTTTTGTCTGCAGTTAGAGGG - Intronic
1008295597 6:49772331-49772353 TGTTTGAGGCAGAAGTTTTATGG + Intergenic
1008672275 6:53782010-53782032 TCTTTTAGGCAGAATATAGTTGG - Intergenic
1009333398 6:62454853-62454875 TCTTGTAGGCAGCATTTAGATGG + Intergenic
1009439057 6:63654701-63654723 TCCCTTAGGCAGCAGTTAGAGGG + Intronic
1009643394 6:66366516-66366538 TATTTTTGTCAAAAGTTAGTTGG - Intergenic
1011318425 6:86062945-86062967 CATTTAAGGCAGTATTTAGAGGG - Intergenic
1011556561 6:88575741-88575763 GATTTCAGGCAGGAGGTAGAGGG + Intergenic
1013924274 6:115449814-115449836 TATTTTAGGCAGCTGAAAGAAGG + Intergenic
1014184213 6:118416868-118416890 TCTTTTATGCATCAGTTAGAAGG - Intergenic
1014298424 6:119649551-119649573 TATTTGGGGCAGATGTTAAATGG + Intergenic
1014672425 6:124321951-124321973 TATTAAAGTCAGAATTTAGAAGG - Intronic
1014739877 6:125136846-125136868 TATTTATGGCAGAAGATAAACGG + Intronic
1016771372 6:147855775-147855797 TTTTATAGGCAGAATTTAGTTGG - Intergenic
1018104363 6:160468741-160468763 TGTGTTTGGCAGAAGGTAGAAGG - Intergenic
1018116101 6:160586909-160586931 TGTATTTGGCAGAAGGTAGAAGG - Intronic
1018647069 6:165958864-165958886 TCTTTTGGGCAGAAGCAAGAGGG - Intronic
1019802909 7:3101446-3101468 TGTTTTAAGCAGAGGATAGAAGG + Intergenic
1020167354 7:5818286-5818308 TATTTCAGCCAGCAGTAAGAGGG - Intergenic
1020804810 7:12776097-12776119 TATTCTAGGCAGAAAAAAGAAGG + Intergenic
1020972605 7:14964542-14964564 TATTACAGACAGAATTTAGATGG + Intronic
1022164738 7:27747007-27747029 TATTTTAGCCATTAGTAAGAAGG - Intronic
1023170173 7:37383748-37383770 TATTTTAGGCAACATTTAAAAGG + Intronic
1023381918 7:39616722-39616744 TAATTTGAGCAGAAGCTAGAAGG + Intergenic
1023383783 7:39634522-39634544 TATTTTAGGCAGAAAGATGATGG - Intronic
1024394119 7:48846715-48846737 TATTTTCGTCAGAAGTTAAAGGG - Intergenic
1024401119 7:48925699-48925721 TATTTTCGTCAGAGGTTAAAGGG + Intergenic
1025706632 7:63871723-63871745 TGTTTATGGCAGATGTTAGAAGG + Intergenic
1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG + Intronic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1027725120 7:81794937-81794959 TATTATAGACAGACTTTAGAGGG - Intergenic
1028019209 7:85749784-85749806 GAGTTCAGGCAGAAGTGAGATGG - Intergenic
1028881134 7:95881125-95881147 TAACTTAGGCAGAAGGGAGAGGG + Intronic
1030537118 7:110782225-110782247 TATTTTAAGCCTAAGGTAGATGG + Intronic
1031652458 7:124307103-124307125 TATTTTATGGAGAAGTAAGTGGG + Intergenic
1031843178 7:126772028-126772050 AATTTTAGGCAGAAGTGGAAAGG - Intronic
1032347784 7:131133145-131133167 GATTTTGAGCAGAAGCTAGATGG + Intronic
1032666062 7:134037636-134037658 CATTTTAGGCACAATTTAGAAGG + Intronic
1033447676 7:141436781-141436803 TATTTTTAGCAGAAGGGAGAGGG - Intronic
1034605507 7:152309483-152309505 TATTTTATGCAAAAATTAGCCGG - Intronic
1034738038 7:153447148-153447170 TGTTTCAGTCAGAAGTTGGAAGG + Intergenic
1041060902 8:54033459-54033481 TATTTATGGCAGAAGGGAGAAGG + Intergenic
1043301407 8:78738637-78738659 TATTATAGGAAAAAGTCAGAAGG + Intronic
1044233038 8:89800960-89800982 CATTTTAGGAAGCAGATAGAAGG - Intergenic
1044744333 8:95357605-95357627 AATTTTGGGCAGTATTTAGAGGG + Intergenic
1045388856 8:101695270-101695292 TATTTTTGCCAGAAGTTTTAAGG + Intronic
1045678879 8:104637519-104637541 TACAGCAGGCAGAAGTTAGAAGG - Intronic
1045814463 8:106263119-106263141 TATTGTAGGCATAAGTTGAATGG - Intergenic
1046052348 8:109038904-109038926 TTTATAAGGAAGAAGTTAGAGGG - Intergenic
1047158905 8:122354082-122354104 TATTTTAGATAGAAGGTAAATGG + Intergenic
1047266247 8:123312162-123312184 GATTTTATGCAGAAGGGAGAAGG - Intergenic
1047456244 8:125015304-125015326 TATTTTAGGCAGCAGATCGTTGG + Intronic
1047934436 8:129763027-129763049 TATTTTAGGAAGATGGGAGAAGG - Intronic
1049570278 8:143367090-143367112 TGATTCAGGCAGAAGTGAGAAGG + Intergenic
1050386095 9:5092631-5092653 TACTTTATGCAGAAGGTATAAGG - Intronic
1054844971 9:69785132-69785154 CATTTTAGCTAGAAGTGAGAGGG + Intergenic
1055415412 9:76077280-76077302 TTTTTGAGGCAGAACTTTGATGG - Intronic
1057238288 9:93384192-93384214 TATTATAGGCAGTAATTAGATGG - Intergenic
1057465325 9:95308715-95308737 AATTTTAGGCAAACATTAGATGG + Intronic
1057608921 9:96523367-96523389 TATTTTCGTCAGAAGTTAAAGGG - Exonic
1058758422 9:108105274-108105296 TATTTCAGGCAGTACTTGGAAGG - Intergenic
1058809764 9:108628072-108628094 AATTGTAGGGAGAAGTGAGAGGG - Intergenic
1060121827 9:120998747-120998769 TATTTGAGCCAGAAGTCAGTGGG - Intronic
1061602194 9:131678595-131678617 TATTTTTGGCAGAAGTGAGACGG + Intronic
1203734437 Un_GL000216v2:122423-122445 TATTATAGGCAGAAACAAGAAGG - Intergenic
1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG + Intergenic
1188629649 X:32338406-32338428 TATTTCACGCAGATGTTTGAGGG + Intronic
1188777041 X:34232583-34232605 TCTTTTAGGCAAAAGATAAATGG - Intergenic
1188874838 X:35417039-35417061 TATTTAAGGAAGAAATTAAAAGG - Intergenic
1190090629 X:47434063-47434085 TATCTTGTGCAAAAGTTAGAGGG - Intergenic
1190379614 X:49827480-49827502 TGCTTTGGGCAAAAGTTAGATGG - Intergenic
1192273640 X:69608536-69608558 AATTTTAAGCAGCAGTTTGAAGG - Intergenic
1192617679 X:72645014-72645036 TTTTTTAGGCAGCAGGTAGCGGG + Intronic
1193965299 X:87977280-87977302 TATTTTAAGCAGAAGTTCTTGGG - Intergenic
1194922552 X:99784468-99784490 TATTTTATTCAGAGGGTAGAGGG + Intergenic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1198391848 X:136183144-136183166 TATTTTGGGCAGAGATTAGTTGG + Intronic
1198657390 X:138929670-138929692 TATTTTAGGCACAAGGGACAGGG - Intronic
1199503136 X:148531321-148531343 TATTTTAGGTACAAGGTAAAGGG + Intronic
1200505127 Y:4002383-4002405 TATTTAAAGCAGTATTTAGAGGG + Intergenic