ID: 1097282062

View in Genome Browser
Species Human (GRCh38)
Location 12:57851133-57851155
Sequence CAGCCCCGATACTCTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097282062_1097282071 -4 Left 1097282062 12:57851133-57851155 CCCAGGGCAGAGTATCGGGGCTG 0: 1
1: 0
2: 1
3: 5
4: 136
Right 1097282071 12:57851152-57851174 GCTGAGATGGGGTGGGGTGAGGG 0: 1
1: 0
2: 17
3: 158
4: 2775
1097282062_1097282072 11 Left 1097282062 12:57851133-57851155 CCCAGGGCAGAGTATCGGGGCTG 0: 1
1: 0
2: 1
3: 5
4: 136
Right 1097282072 12:57851167-57851189 GGTGAGGGAGAGAGACCCAGTGG 0: 1
1: 0
2: 5
3: 93
4: 907
1097282062_1097282069 -10 Left 1097282062 12:57851133-57851155 CCCAGGGCAGAGTATCGGGGCTG 0: 1
1: 0
2: 1
3: 5
4: 136
Right 1097282069 12:57851146-57851168 ATCGGGGCTGAGATGGGGTGGGG 0: 1
1: 0
2: 2
3: 32
4: 411
1097282062_1097282070 -5 Left 1097282062 12:57851133-57851155 CCCAGGGCAGAGTATCGGGGCTG 0: 1
1: 0
2: 1
3: 5
4: 136
Right 1097282070 12:57851151-57851173 GGCTGAGATGGGGTGGGGTGAGG 0: 1
1: 3
2: 46
3: 490
4: 3720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097282062 Original CRISPR CAGCCCCGATACTCTGCCCT GGG (reversed) Intergenic
900529776 1:3147436-3147458 CAGCACAGATACACTGCCCAGGG - Intronic
902380808 1:16051439-16051461 CAGCCTCTAACCTCTGCCCTGGG + Intronic
903138285 1:21323334-21323356 CAGGCCGGATACTCTGCCAGGGG + Intronic
907481662 1:54749112-54749134 CAGCCTCGATGCTCTGCTCGTGG - Intergenic
907892644 1:58650166-58650188 CAGCCCAGCTTCTCTGCCCAGGG - Intergenic
915470034 1:156120400-156120422 CAGCCTGGAAACTCTGCTCTGGG + Intronic
917369542 1:174276183-174276205 ATGCCCCTATACTCTACCCTGGG - Intronic
917590835 1:176475383-176475405 AAGCCCAGATTCTCTGCTCTTGG + Intronic
917693728 1:177495988-177496010 CAGCCCGAATACCCTCCCCTTGG + Intergenic
919776439 1:201197184-201197206 TAGCCCTGTTCCTCTGCCCTTGG + Intronic
920038587 1:203081768-203081790 TAGCCCTGATTCACTGCCCTGGG - Intergenic
923847344 1:237749866-237749888 CAGCCACGATACACTGCACCTGG - Intronic
1062840288 10:665015-665037 CAGCACCTGTACTCTCCCCTAGG + Intronic
1063217073 10:3934296-3934318 GAACCCCGATAGTGTGCCCTAGG + Intergenic
1066234819 10:33475554-33475576 CAGTCCCGTTCCTCTGCCATAGG - Intergenic
1069894444 10:71671976-71671998 CAGGCCCTATACTAGGCCCTGGG + Intronic
1070306866 10:75244949-75244971 CAGCCCCTACACCCTGCCCGTGG - Intergenic
1070823948 10:79380140-79380162 CTGCCCTGATACGCTGCACTGGG + Intergenic
1072169680 10:92847764-92847786 CAACCCAGCTACTCTGACCTGGG + Intronic
1072204648 10:93192425-93192447 CAGCCCAGACACTCTGTCTTGGG + Intergenic
1074158094 10:110815661-110815683 CACTCCTGAGACTCTGCCCTGGG + Intronic
1075150099 10:119921096-119921118 CAGCTCCATTACTGTGCCCTAGG - Intronic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1076752327 10:132549759-132549781 CAGCCCCCACTCTCTGCCCCTGG + Intronic
1083664411 11:64266765-64266787 CAACCCTGATACATTGCCCTGGG + Intronic
1084833597 11:71787444-71787466 CTGCCCCGGTGCACTGCCCTGGG + Intergenic
1088987924 11:114926427-114926449 CAGCCCCAAGTCTCTGCTCTAGG - Intergenic
1091343431 11:134837418-134837440 CAGCCCCGATCCTCTGCTAGGGG + Intergenic
1091590786 12:1841995-1842017 CAGCCCCGACAATATTCCCTGGG + Intronic
1091876074 12:3933936-3933958 CAGTCCCCACACCCTGCCCTTGG - Intergenic
1096199740 12:49673129-49673151 CAGCCCCCACACTCAGCCCATGG + Intronic
1097282062 12:57851133-57851155 CAGCCCCGATACTCTGCCCTGGG - Intergenic
1103946776 12:124531561-124531583 CAGCCTGGATGCTCAGCCCTGGG - Intronic
1104745287 12:131206806-131206828 GAGCCCCCACCCTCTGCCCTTGG + Intergenic
1104789050 12:131470300-131470322 GAGCCCCCACCCTCTGCCCTTGG - Intergenic
1104987004 12:132602973-132602995 CAAACCCGATACTCTGGCCCTGG + Intergenic
1107303968 13:38998197-38998219 CAGCACAGATATTCTGTCCTTGG + Intergenic
1108071069 13:46629140-46629162 CAGCCCTGGAACTTTGCCCTTGG - Intronic
1114671767 14:24415370-24415392 CAGCCCCTATGCTGTGGCCTGGG + Exonic
1118367223 14:65106217-65106239 CAGCCCCGATAAGCTCACCTGGG - Intergenic
1119514527 14:75237528-75237550 CAGGCTCGACACTCTGCCATCGG - Intergenic
1122118785 14:99540897-99540919 CATCCCAGATACCCTGCACTGGG + Intronic
1122816967 14:104318742-104318764 CAGCCCAGCTCCTCTGCCCCGGG - Intergenic
1129034042 15:72639231-72639253 CTGCCCTGAAACTCTGCACTAGG + Intergenic
1129215840 15:74097985-74098007 CTGCCCTGAAACTCTGCACTAGG - Intergenic
1129408966 15:75338470-75338492 CTGCCCTGAAACTCTGCACTAGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132472417 16:112984-113006 CAGCCCCCATGCTCTGTTCTTGG + Intronic
1136748633 16:32614035-32614057 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1137626128 16:49909957-49909979 CAGCCCCCAGAGACTGCCCTGGG + Intergenic
1139748236 16:69091814-69091836 CATCTCTGAGACTCTGCCCTTGG + Intergenic
1203050766 16_KI270728v1_random:873249-873271 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1145977355 17:28992028-28992050 CAGGCCAGATACTCTGCCCTCGG - Intronic
1146643202 17:34556568-34556590 CAGCCACGAAACTCTGTCCATGG - Intergenic
1149380099 17:56084948-56084970 GAGCCCAGATTGTCTGCCCTGGG - Intergenic
1149778096 17:59374103-59374125 GAACCCCGATACTCTGAACTGGG - Intronic
1151445928 17:74163987-74164009 GTGCCCCGACACTCAGCCCTTGG + Intergenic
1151930317 17:77228024-77228046 CTGCCCACATTCTCTGCCCTGGG + Intergenic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152448136 17:80358384-80358406 CAGGCCAGATACTCCGCCCTGGG + Exonic
1152645567 17:81467062-81467084 CAGCCCCCTTACTCAGCGCTCGG - Intergenic
1160674889 19:384707-384729 CAGCTCCTATGCTCTGCCCCAGG - Intergenic
1161747404 19:6069546-6069568 CAGCCCCAGAACTCAGCCCTAGG - Intronic
1163668052 19:18612273-18612295 CAGCCCTGATCCACTGACCTAGG - Intronic
1164412331 19:28016343-28016365 CAGGCCCCATACTCAGCACTGGG + Intergenic
1164972892 19:32547703-32547725 CATCTCCCCTACTCTGCCCTAGG + Intergenic
1167332996 19:48867845-48867867 AAGCCCCTATTCTCTGGCCTGGG - Intronic
1168705884 19:58470021-58470043 CAACCCCGCTCCTGTGCCCTTGG - Intronic
929545677 2:42854157-42854179 AAGGCCTGAGACTCTGCCCTGGG - Intergenic
929601227 2:43206088-43206110 CAGCCCAGAGACTGTGCTCTGGG + Intergenic
931810865 2:65853793-65853815 CAGCCCAGATTCTCTTCTCTTGG + Intergenic
934704605 2:96468111-96468133 CTGACCCGGTCCTCTGCCCTTGG + Intergenic
937777152 2:125791713-125791735 CATCCTCGATGCTGTGCCCTGGG + Intergenic
945545498 2:211145161-211145183 CAGCCCCGTTACCCTACTCTGGG - Intergenic
947195720 2:227565122-227565144 CAGCCCCACTTCCCTGCCCTTGG - Intergenic
947901016 2:233721843-233721865 CAGCCCCACTGCTCGGCCCTGGG + Intronic
948013985 2:234672801-234672823 CAGACCCCATACCCTTCCCTAGG - Intergenic
948100778 2:235371019-235371041 CAGCCCTGATCTTGTGCCCTGGG - Intergenic
948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG + Intronic
948644202 2:239393555-239393577 CAGCCCCGAAACTCTGGCTCTGG + Intronic
948771865 2:240255292-240255314 CTGCCCAGTTCCTCTGCCCTTGG + Intergenic
1173672193 20:44806338-44806360 CAGCCCTGACACTCTGCCTTGGG - Intronic
1175661987 20:60821343-60821365 GAGCCCAGATACTCACCCCTGGG + Intergenic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1176103050 20:63373157-63373179 CATGCCCGAGGCTCTGCCCTGGG - Intronic
1179584273 21:42365012-42365034 CAGCCCCGGTGCTCTGCCTCCGG + Intronic
1179720474 21:43313566-43313588 CAGCCCCGACACTCAGGCCCTGG - Intergenic
1180114150 21:45685780-45685802 CAGCCCCAAAAATCTGCACTGGG + Intronic
1181362603 22:22349594-22349616 CAGCCCTGCAACCCTGCCCTGGG - Intergenic
1184098040 22:42327168-42327190 CAGCCTCCAGACTCAGCCCTGGG - Intronic
1184247523 22:43243206-43243228 AAGCCCTGATTCTCTGGCCTTGG - Intronic
960153502 3:114274861-114274883 CAGCCCTGAGACTCTCCCTTCGG + Intergenic
963186610 3:142424952-142424974 CAGCCCCATTTCTCTGACCTTGG + Intronic
964495634 3:157286900-157286922 CAACCCTGACACTCAGCCCTGGG - Intronic
966711898 3:182980369-182980391 CAGCCCCGAGCCTCGGCCCGCGG - Intronic
966882348 3:184357573-184357595 CAGCCCCACAACCCTGCCCTTGG - Intronic
968482912 4:844700-844722 CAGCCCCCACATTCTGGCCTTGG - Intergenic
969172714 4:5376845-5376867 CTGGCCCCATGCTCTGCCCTCGG + Intronic
969572893 4:8020419-8020441 CAGCCCAGATCCCCTGCCCAGGG + Intronic
970610309 4:17719290-17719312 CAGCGCCGATACTCTGGACAAGG + Intronic
972637934 4:40900917-40900939 CAGACCAAACACTCTGCCCTAGG + Intronic
973278700 4:48336870-48336892 AAGTCCCAATAATCTGCCCTAGG - Intergenic
975974794 4:80082302-80082324 CAGCCCAGATACTATGACATTGG + Intronic
982584767 4:157222421-157222443 CAGCCCCGCTCCTCGCCCCTCGG - Intronic
985197021 4:187442631-187442653 CAGCCCCATGACTTTGCCCTGGG + Intergenic
985694409 5:1331755-1331777 CTGCTCAGATACTCTGCCCCAGG - Intronic
986606918 5:9531761-9531783 CAGACCCTAGGCTCTGCCCTGGG - Intronic
990383706 5:55239092-55239114 CTGCCCCCTTACTCTGCTCTAGG - Intergenic
996425103 5:123305467-123305489 AAGCCCCAGTACTCTCCCCTAGG + Intergenic
999087600 5:148906792-148906814 CAGACACCATACTGTGCCCTGGG + Intergenic
999407773 5:151322543-151322565 CAGGCCAGATACTTTGCCCAGGG + Intronic
1000310410 5:160038028-160038050 CACCCCCGCAACCCTGCCCTGGG - Intronic
1001990509 5:176112410-176112432 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002226363 5:177725730-177725752 CTGCCCAGAGGCTCTGCCCTGGG + Intronic
1002267484 5:178045483-178045505 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002422840 5:179158613-179158635 CTGCCCTGACACTCTTCCCTGGG + Intronic
1006397795 6:33798427-33798449 CAGCCCCAACAATCGGCCCTGGG + Intronic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1020452867 7:8339798-8339820 CAGCCCCGGTAATCTGGGCTGGG - Intergenic
1021934628 7:25617629-25617651 CATGCCTGATATTCTGCCCTTGG - Intergenic
1023849507 7:44142207-44142229 CAGCCCCTCTGCTGTGCCCTCGG - Intergenic
1030931970 7:115535827-115535849 TAGCCCTGATAATCTGCCTTAGG - Intergenic
1034357829 7:150466974-150466996 CAGCCTCCATGCTCTGCTCTTGG + Exonic
1038848627 8:31253022-31253044 AAACCCTGTTACTCTGCCCTTGG - Intergenic
1046673179 8:117079969-117079991 CAGGCCCTCTACTCTGCACTTGG + Intronic
1048469881 8:134696445-134696467 CATCCCTCCTACTCTGCCCTTGG - Intronic
1049278679 8:141732930-141732952 CAGCCCCGAGACTCAGCCTCGGG - Intergenic
1049471485 8:142776860-142776882 CTGCCGGGATACTCGGCCCTCGG + Intronic
1049601166 8:143508316-143508338 CAGCCCCGCCCCTCTGGCCTGGG - Intronic
1053224781 9:36345046-36345068 CAGCCGCTATACTCTAGCCTGGG - Intronic
1053295176 9:36907558-36907580 CAGCCCCGATCCTCAGGGCTAGG - Intronic
1054810850 9:69432755-69432777 CTGCCCCTACACTCTGCTCTTGG + Intronic
1057696250 9:97324831-97324853 CAGACCTGAAACGCTGCCCTAGG + Intronic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1061247478 9:129408147-129408169 CAGCCCTGATCCTCTGCTCCGGG + Intergenic
1062076845 9:134594351-134594373 CAGCCCAGAGACTCCGCCCCAGG + Intergenic
1062265297 9:135684107-135684129 CAGCTCCGCTCCTCTGCCCAGGG + Intergenic
1189350418 X:40271612-40271634 CAGCCTCGATTCTCTCTCCTGGG + Intergenic
1190284888 X:48955393-48955415 GAGCCCTGAGACTCTTCCCTTGG - Intronic
1192442280 X:71183417-71183439 CAGCCCCGCTGCTCTCCCTTTGG + Intergenic
1194948101 X:100092124-100092146 CAGCACAGACACTCTGTCCTGGG + Intergenic
1197819857 X:130531592-130531614 CACCCCCGCTTCTCAGCCCTGGG + Intergenic
1201950119 Y:19554628-19554650 TGGCCCCGATGCTCTGCCATTGG + Intergenic