ID: 1097282196

View in Genome Browser
Species Human (GRCh38)
Location 12:57852009-57852031
Sequence CTGCCTGTGCAAAGGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097282196_1097282200 -9 Left 1097282196 12:57852009-57852031 CCTCCCTACCTTTGCACAGGCAG No data
Right 1097282200 12:57852023-57852045 CACAGGCAGTTCTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097282196 Original CRISPR CTGCCTGTGCAAAGGTAGGG AGG (reversed) Intergenic
No off target data available for this crispr