ID: 1097285560

View in Genome Browser
Species Human (GRCh38)
Location 12:57874386-57874408
Sequence CGGAAAAAGGAAAAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097285560_1097285565 -3 Left 1097285560 12:57874386-57874408 CCAGGCTCCTTTTCCTTTTTCCG No data
Right 1097285565 12:57874406-57874428 CCGCTCTGTGGCTGATCTCCTGG No data
1097285560_1097285566 9 Left 1097285560 12:57874386-57874408 CCAGGCTCCTTTTCCTTTTTCCG No data
Right 1097285566 12:57874418-57874440 TGATCTCCTGGATTCTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097285560 Original CRISPR CGGAAAAAGGAAAAGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr