ID: 1097287556

View in Genome Browser
Species Human (GRCh38)
Location 12:57889496-57889518
Sequence CCTGAGGCCCAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097287550_1097287556 -10 Left 1097287550 12:57889483-57889505 CCACCCTGAGTGTCCTGAGGCCC No data
Right 1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG No data
1097287548_1097287556 6 Left 1097287548 12:57889467-57889489 CCGAAGCAAGGACAGGCCACCCT No data
Right 1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097287556 Original CRISPR CCTGAGGCCCAGAGGGAAGC AGG Intergenic
No off target data available for this crispr