ID: 1097288469

View in Genome Browser
Species Human (GRCh38)
Location 12:57895340-57895362
Sequence AACCTATATTTTTCTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 458}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097288467_1097288469 -4 Left 1097288467 12:57895321-57895343 CCTCTTGAATCCTTATGTTAACC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1097288469 12:57895340-57895362 AACCTATATTTTTCTTCTCCAGG 0: 1
1: 0
2: 3
3: 37
4: 458
1097288466_1097288469 17 Left 1097288466 12:57895300-57895322 CCTGAACACACAGAGTGTCATCC 0: 1
1: 0
2: 1
3: 11
4: 115
Right 1097288469 12:57895340-57895362 AACCTATATTTTTCTTCTCCAGG 0: 1
1: 0
2: 3
3: 37
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097288469 Original CRISPR AACCTATATTTTTCTTCTCC AGG Intergenic
904640051 1:31919658-31919680 TACTTATTCTTTTCTTCTCCAGG - Exonic
905614270 1:39383333-39383355 AACAAATATTTTTCTAATCCGGG + Intronic
906444196 1:45880122-45880144 AAGCTATATTTCACTTCTCTTGG - Intronic
906814208 1:48861504-48861526 AACCTATTTTTTTCTTGGGCAGG - Intronic
907022041 1:51077000-51077022 AAAGTATAATTTTCTTCTCATGG + Intergenic
907199800 1:52716833-52716855 AATCTACCTTTTTCTTCTCTGGG + Intergenic
907863101 1:58372591-58372613 AAACCATATTATTCTTCTCCTGG - Intronic
908118258 1:60962037-60962059 GACCTCTATTTTTCCTCTCAAGG + Intronic
909345877 1:74586436-74586458 AACCTTTACTCTTTTTCTCCAGG - Intronic
909987827 1:82184233-82184255 AACCCATATTTTAATACTCCTGG + Intergenic
910512333 1:88021312-88021334 AAACTATATCATTCTGCTCCTGG + Intergenic
911249959 1:95564195-95564217 AACCTATGTTTTATTTCTCCTGG + Intergenic
911790257 1:102006003-102006025 AACTTAATTTATTCTTCTCCTGG + Intergenic
911928684 1:103871666-103871688 AACCTGTGTTTTTATTCACCAGG + Intergenic
911928738 1:103872525-103872547 AACCTATGTTTTTATTCACCAGG + Intergenic
912325407 1:108754427-108754449 AGCCTTGATTTTTCTACTCCTGG + Intronic
912485336 1:110022774-110022796 AAGCTAGATTTTTCTTGCCCTGG - Exonic
912564407 1:110576164-110576186 AAGCTATGCTTTTCTTCTCTTGG + Intergenic
914882286 1:151556567-151556589 AACATGTTTTTTTCTTATCCAGG - Intronic
915058331 1:153158064-153158086 AAGCCATATTATTCTGCTCCTGG + Intergenic
916221093 1:162445793-162445815 AGCCTATGTTTTCCATCTCCAGG - Intergenic
916683510 1:167125062-167125084 TATATATATTTTTCTTTTCCTGG - Intronic
916858180 1:168773583-168773605 AACTACTAATTTTCTTCTCCAGG - Intergenic
917008996 1:170449720-170449742 AACTTTTCTTTTTCTGCTCCTGG + Intergenic
917057300 1:170997064-170997086 AACTTTTATTTTTCTTGTACTGG + Intronic
917418276 1:174834453-174834475 AACCTGTGTTTTTTTTCTCTGGG + Intronic
918660755 1:187085206-187085228 AAGCTATATTGTTTGTCTCCAGG + Intergenic
918801122 1:188973153-188973175 ATCCTATTTTTTTCTTCCACGGG + Intergenic
918873630 1:190009576-190009598 AACCTTTATATTTCTTCCTCAGG - Intergenic
918898611 1:190382084-190382106 AAAATATATTTTTCTACTTCTGG + Intronic
918938104 1:190951159-190951181 AACTTTTATTTTACTTCACCAGG - Intergenic
919017457 1:192057555-192057577 AGCTTATCTTTCTCTTCTCCAGG + Intergenic
922045368 1:221940233-221940255 GAACAATATTTTTTTTCTCCAGG + Intergenic
924140279 1:241015136-241015158 AAGCTTTAGTTTTCATCTCCAGG + Intronic
924394868 1:243607720-243607742 AAACTATATCATTCTGCTCCTGG - Intronic
1063535943 10:6883609-6883631 AACTTACATTTGTCTTCTCTGGG + Intergenic
1064366541 10:14713650-14713672 AAATTATGATTTTCTTCTCCTGG - Intronic
1064367110 10:14718020-14718042 ATTCAATATATTTCTTCTCCTGG - Intronic
1065023605 10:21520589-21520611 ATCCTTTTTTTTTTTTCTCCAGG + Intronic
1065474163 10:26116335-26116357 CACCTAAATTTGTCTTCACCTGG + Intronic
1066094959 10:32063299-32063321 AACCTCCATTTCTGTTCTCCAGG + Intergenic
1066796209 10:39124312-39124334 AACCTTTCTTTTTATTCTACAGG + Intergenic
1066928748 10:41730469-41730491 AACCTTTCTTTTTATTCACCGGG + Intergenic
1068805661 10:61191844-61191866 AAACTGTATCTTTCTGCTCCTGG + Intergenic
1069554942 10:69391767-69391789 TACGTATATATTTCTTCTTCTGG + Intronic
1070908856 10:80100030-80100052 ATCCCTAATTTTTCTTCTCCAGG - Intergenic
1073025673 10:100485671-100485693 AACATAAATATTTCTCCTCCAGG - Intergenic
1074927059 10:118084371-118084393 AAACTATATTTTTCTGCCCCTGG + Intergenic
1075322527 10:121503617-121503639 AATCCATTTTTTTCTTTTCCAGG + Intronic
1075861583 10:125681428-125681450 AACTTACATTTTTCTTTTCATGG + Intronic
1075883442 10:125875315-125875337 AAACCATTTTTTTTTTCTCCAGG - Intronic
1076244753 10:128938195-128938217 AACACATATTTTTTTTTTCCTGG - Intergenic
1077737288 11:4804647-4804669 AATCAATATTTTTCTTGACCAGG + Intronic
1079146861 11:17860266-17860288 ATGCTATACTTTTCTTTTCCTGG - Intronic
1079567870 11:21904702-21904724 CCCCTACATTTTTATTCTCCAGG - Intergenic
1079628272 11:22642545-22642567 ATTCTATAATTTTCTTATCCAGG - Intronic
1080058961 11:27936818-27936840 AACACATATTTTTTTTCTCTAGG + Intergenic
1080290771 11:30668798-30668820 AAGCTATATTTTTATTTTCATGG - Intergenic
1080523527 11:33089381-33089403 AACCAATTTTTTTCTTATCAAGG + Intronic
1080949362 11:37012487-37012509 AACCATTTTTTTTCTTTTCCAGG + Intergenic
1082128800 11:48462405-48462427 AACAAATACTTTTCATCTCCAGG - Intergenic
1085049493 11:73372895-73372917 CCCCTAGATTTCTCTTCTCCAGG + Intergenic
1085885933 11:80521846-80521868 AACCTAGATTTTTGTCCTGCAGG - Intergenic
1086257993 11:84902761-84902783 AAACTGTTATTTTCTTCTCCAGG + Intronic
1086306902 11:85489907-85489929 AAAATATTTTTTTCTTGTCCAGG + Intronic
1086729196 11:90227315-90227337 AAACTATATAATTCTTCTCCTGG + Intergenic
1086788840 11:91008618-91008640 AATGTATATTTTTCTTTTCTTGG - Intergenic
1086805591 11:91238128-91238150 AAACTATTTTTTTCTTCTTCTGG + Intergenic
1087301471 11:96440890-96440912 AAGCTATATTGTTTTTCTTCAGG + Intronic
1087636458 11:100707234-100707256 AACATATATTTTCATTCTCTTGG + Intronic
1087744031 11:101922102-101922124 AAAGTAGATTTTTTTTCTCCAGG + Intronic
1088126549 11:106432688-106432710 AATTTATTATTTTCTTCTCCTGG - Intergenic
1089461520 11:118656938-118656960 CACCTCTACTTTTCTTCTTCTGG - Exonic
1090319111 11:125826182-125826204 AACTTCCATTTCTCTTCTCCGGG + Intergenic
1092403396 12:8197137-8197159 AAACCATATTATTCTGCTCCTGG + Intergenic
1092832093 12:12454165-12454187 AACATATAATTTACTTCTCTTGG + Intronic
1093066409 12:14662840-14662862 CTCCTATATTTTTCTTTGCCAGG - Intronic
1093156294 12:15689889-15689911 TACCAATGTTTCTCTTCTCCTGG - Intronic
1095039810 12:37428219-37428241 AAACCATATTTTTCCACTCCTGG - Intergenic
1095047432 12:37523297-37523319 AACCTGTATTTTGCTTCAGCAGG - Intergenic
1095755555 12:45762746-45762768 AACCTATATCTTACTTCTAAAGG + Intronic
1096991730 12:55809854-55809876 AACTTACCTGTTTCTTCTCCAGG - Intronic
1097288469 12:57895340-57895362 AACCTATATTTTTCTTCTCCAGG + Intergenic
1097583712 12:61489997-61490019 ATCATACATTTTTCTTCTCTGGG - Intergenic
1097909465 12:64953965-64953987 ATCCTTCATTTTTGTTCTCCAGG - Intergenic
1098419825 12:70283558-70283580 AAACTCAATTTTTCTTCTCTGGG - Intronic
1098651383 12:72974971-72974993 AACATAAATTTTTATTCTCTTGG - Intergenic
1099216122 12:79855588-79855610 AACTTTTACTTTTCTTCTGCTGG - Intronic
1099704804 12:86138326-86138348 ACCCTAGACTTTTCTTCTCAGGG + Intronic
1099726409 12:86433929-86433951 AAGCTACATATTTCCTCTCCTGG + Intronic
1099763158 12:86945761-86945783 AACTTAACTTTTTCCTCTCCAGG + Intergenic
1099802587 12:87475130-87475152 AAACCATATTATTCTGCTCCTGG - Intergenic
1099885236 12:88521732-88521754 AATCTATATGTTTCTTCTTTTGG - Intronic
1101057931 12:100938566-100938588 AACCCATATCTTTCCTCTGCTGG + Intronic
1101388059 12:104275291-104275313 AAATTATGTTTTTCTTCTTCTGG + Intronic
1101687658 12:107041810-107041832 CAGCTTTATTTTTCTTTTCCTGG - Intronic
1101993908 12:109511182-109511204 AACCCATGTCTTTCTTCTCAAGG + Exonic
1106400956 13:29429806-29429828 GCCATATATTTTCCTTCTCCTGG - Intronic
1107055271 13:36096506-36096528 TACCTATTTCTTTCTTCTCAAGG - Intronic
1108088874 13:46824685-46824707 ATCCTATGTTTTTCTTCTCATGG + Intergenic
1109673026 13:65635499-65635521 ATTCCATATTTTTCTTGTCCAGG - Intergenic
1109861875 13:68210622-68210644 ATCCTTGATTTTTCTTCTTCTGG - Intergenic
1110809982 13:79801936-79801958 AAGCTATTTTGCTCTTCTCCAGG + Intergenic
1111045993 13:82813448-82813470 AAACTATATTGTTCCTCCCCTGG - Intergenic
1111385575 13:87522198-87522220 AACCCATATCTTTCTGCCCCTGG - Intergenic
1111592839 13:90371872-90371894 AAACTATGTTTTTGTTATCCAGG - Intergenic
1112220466 13:97484589-97484611 AGCCAATATTTTTATTGTCCAGG - Intergenic
1112865140 13:103886132-103886154 AACCTATGCTTTCCTTCACCAGG + Intergenic
1113422135 13:110179036-110179058 ACTCTCAATTTTTCTTCTCCAGG - Exonic
1114778562 14:25514065-25514087 AAACTATATTATTCTGCCCCTGG + Intergenic
1114839229 14:26244015-26244037 AACAAATAGTTTTCTTTTCCAGG - Intergenic
1115085198 14:29507041-29507063 GAGCCATATTTTTCTTCTCACGG - Intergenic
1115360955 14:32501573-32501595 AACCTATTTTTTTTTCCTCCTGG - Intronic
1115889753 14:38013109-38013131 AAACTATATTATTCTACCCCTGG - Intronic
1116714059 14:48406312-48406334 AACCTATATCATTTTTCCCCTGG + Intergenic
1117130181 14:52678472-52678494 AACATATTTTTTTCTTTTTCAGG - Exonic
1117252203 14:53949195-53949217 AACTTATTTTTTTTTTCTCCAGG - Intergenic
1118083461 14:62388138-62388160 AAACCATATTATTCTTCCCCTGG - Intergenic
1118365081 14:65087815-65087837 AAACTATATTATTCTGCTCCTGG - Intronic
1119023063 14:71131315-71131337 AACCTTTTTTCTTCTTCACCAGG + Intergenic
1119845838 14:77829071-77829093 ATCCTGTATTTTCCTTGTCCTGG + Intronic
1120075642 14:80155106-80155128 AAGCTAAATTTTTCATCTCTAGG + Intergenic
1120693681 14:87620906-87620928 AAACTATATTATTCTGCTCCTGG + Intergenic
1121164153 14:91775774-91775796 TAACTATATTTTTGTTTTCCTGG - Intronic
1122399120 14:101457301-101457323 CACTCATATTTTTCTTTTCCCGG - Intergenic
1124026938 15:25975416-25975438 AATCTTTATTTTACTTCCCCAGG - Intergenic
1124410946 15:29436202-29436224 CAGCTACATTTTTCTTCTCCAGG - Intronic
1124836315 15:33198984-33199006 ACCCTATATATTTCTTCATCTGG + Intergenic
1126065446 15:44822826-44822848 AAACTTTTTTTTTCTCCTCCAGG - Intergenic
1126094387 15:45077766-45077788 AAACTTTTTTTTTCTCCTCCAGG + Intergenic
1126184975 15:45823047-45823069 AAACTATATCATTCTACTCCGGG + Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1129414777 15:75369300-75369322 CAGCTTTATTTTTTTTCTCCTGG + Intergenic
1130358665 15:83159690-83159712 AACTTGTTCTTTTCTTCTCCAGG - Intronic
1131321112 15:91392102-91392124 CATCCATATTTGTCTTCTCCAGG - Intergenic
1131412132 15:92218282-92218304 AGCCTGTATTCTTCTTGTCCAGG - Intergenic
1133059082 16:3162700-3162722 AGGCCATATTTTTCTTCTCTTGG + Intergenic
1133173420 16:3996442-3996464 CACCTATTTTATTCTTCTCTTGG - Intronic
1133620928 16:7525684-7525706 CACCTCAATTTTTCTTCTCCAGG - Intronic
1134872517 16:17664821-17664843 ACCCTATATATTACTTCACCCGG - Intergenic
1135901541 16:26464667-26464689 AACCTATATTGCTCTCCGCCTGG + Intergenic
1136872382 16:33819415-33819437 AAACCATATCATTCTTCTCCTGG + Intergenic
1137045241 16:35650498-35650520 AACCCATATTTTGATTCACCAGG + Intergenic
1137045667 16:35657249-35657271 AACCTTTATTTTGGTTCACCAGG + Intergenic
1137047172 16:35677835-35677857 AACGTATGTTTTTATTCACCAGG + Intergenic
1137050592 16:35710033-35710055 AACCTCTATTTTAATTCACCAGG + Intergenic
1138858978 16:60731930-60731952 AACCTTTTTTTTCCCTCTCCCGG - Intergenic
1139044677 16:63042154-63042176 AACCTAAATTTTTGTTCTTAAGG - Intergenic
1140444828 16:75017567-75017589 AATCTATATTGATCTGCTCCTGG + Intronic
1203099790 16_KI270728v1_random:1296653-1296675 AAACCATATCATTCTTCTCCTGG - Intergenic
1144175327 17:12699585-12699607 AACCTGAATTTTTGTTGTCCTGG - Intronic
1144257336 17:13481715-13481737 AAACCATATTATTCTGCTCCTGG - Intergenic
1144412732 17:15017190-15017212 AATATGTATTTTTTTTCTCCAGG - Intergenic
1145363779 17:22235165-22235187 AACCTTTATTTTTATTCATCAGG - Intergenic
1145410720 17:22659795-22659817 AACCTGTGTTTTGCTTCTGCAGG - Intergenic
1146502999 17:33380565-33380587 AATCTATATTCTTCTCCTCAGGG + Intronic
1147399184 17:40169286-40169308 TTCCTAACTTTTTCTTCTCCTGG + Intronic
1149019920 17:51951036-51951058 AATATATATTATTCTTCACCAGG + Intronic
1150021439 17:61618186-61618208 AACCTAAATGTATCTTCTCATGG + Intergenic
1150138634 17:62710501-62710523 AACCTAGATTTTTTTTTTTCTGG - Intronic
1151122384 17:71807660-71807682 AACCTAGATTTTGCCTCTCTTGG - Intergenic
1153283655 18:3437434-3437456 AATTTATATTATTTTTCTCCTGG + Intronic
1153505986 18:5798670-5798692 AACCTGTGTCTTTATTCTCCAGG - Intergenic
1153695894 18:7641183-7641205 AACCTATATCTTCCTTCTCCAGG + Intronic
1154392187 18:13947535-13947557 CACCTTTATTTTTTTTCTTCTGG - Intergenic
1155213470 18:23622009-23622031 AACCTCCATGTCTCTTCTCCAGG - Intronic
1155773455 18:29728248-29728270 AAACTATATCATTTTTCTCCTGG - Intergenic
1156241100 18:35254961-35254983 AACCTGTATTTCTTTTCTCTGGG - Intronic
1157057009 18:44241774-44241796 TACCCATCTTTTTCTTCTCCAGG + Intergenic
1159595723 18:70381152-70381174 AACCTACATATCTCTTCTCAAGG - Intergenic
1159952054 18:74491829-74491851 AACATGTATTTTCCTACTCCTGG + Intergenic
1164369440 19:27630568-27630590 AACCTTTATTTTGATTCACCAGG + Intergenic
1164377871 19:27705297-27705319 AACCAATATTATGCTTCTCTTGG + Intergenic
1164379748 19:27721987-27722009 AACCTGTGTTTTACTTCACCAGG - Intergenic
1164379978 19:27725783-27725805 AACCTGTGTTTTGATTCTCCAGG - Intergenic
1165641796 19:37395093-37395115 TGCCTATTTTTTTCTTTTCCTGG - Intergenic
1166583217 19:43921440-43921462 AAGCTAGATTTTTCTTACCCAGG - Intronic
1168127930 19:54297336-54297358 AACATATATTTTTTTTTGCCGGG + Intergenic
926050630 2:9742251-9742273 AATCTGCATTTTTCTTTTCCTGG + Intergenic
926855479 2:17251695-17251717 CACTTATATTTTTGTTCACCAGG + Intergenic
928357157 2:30628467-30628489 AAACTATACTTGGCTTCTCCTGG - Intronic
928735045 2:34278646-34278668 AACCTCTATTTAACCTCTCCTGG + Intergenic
928861239 2:35859558-35859580 ACGCTATACTTTTCTTCTCAGGG - Intergenic
929202194 2:39247410-39247432 AAATTAGATTTTTTTTCTCCAGG - Intergenic
929386689 2:41416145-41416167 AAACAATCTTTTTCTTCTCATGG + Intergenic
929609937 2:43263436-43263458 AACATACATTTTTCTTCTCACGG - Intronic
929700238 2:44156427-44156449 AAACTATTTTTTTTTTCCCCTGG - Intergenic
930226743 2:48801678-48801700 AACATTAATTTTTCTTTTCCAGG - Intergenic
930773796 2:55153260-55153282 TAGCTATATTTTTATTCCCCTGG - Intergenic
932123148 2:69119444-69119466 AACCTATATTTATTTCCTCGTGG - Intronic
932553635 2:72797973-72797995 CAGATATATTTTTCTTCTCAAGG - Intronic
933639773 2:84747104-84747126 AAACTATATTATTCCACTCCTGG + Intronic
934117558 2:88811411-88811433 AGCCTTTATTTTCCTTTTCCTGG - Intergenic
934891525 2:98074567-98074589 AAACTATATTATTCTGCCCCTGG + Intergenic
935239851 2:101168947-101168969 AAACTATATCATTCTTCCCCTGG - Intronic
935789086 2:106574771-106574793 TACCTATTTTTTTTTTCTGCTGG - Intergenic
937618310 2:123953850-123953872 AACCGATATTTATTTTCTCATGG + Intergenic
938223257 2:129590777-129590799 ATCCTTTATTTTTCTTCTAATGG - Intergenic
938859405 2:135351582-135351604 AACCTATTACTTTCTTCTTCAGG - Intronic
939587998 2:144028678-144028700 AATATATATTGTTCTTCTACTGG + Intronic
939650751 2:144759164-144759186 AACCTATACTTTTCCTCCACTGG + Intergenic
939827117 2:147028225-147028247 AAACTATATTATTCTGCCCCTGG + Intergenic
941013674 2:160330667-160330689 AACCTATATTTTAGTTATTCTGG - Intronic
941304174 2:163840991-163841013 CACCTCTATTTTTCTTCTTTTGG - Intergenic
941422657 2:165302137-165302159 AACCTGTATATTTCTTTTCATGG - Intronic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
942455010 2:176131407-176131429 AACCTCGATTCTTCTTTTCCTGG - Exonic
943336649 2:186623362-186623384 GAACTAAATTTTTCTTCTCTTGG + Intronic
943811082 2:192190204-192190226 AACCCCTTTTTTTTTTCTCCTGG + Intronic
945335698 2:208590285-208590307 AACCTCTGTTTTTGTTCTCAAGG + Intronic
946172429 2:217903457-217903479 ATCCTATTCTTTTCCTCTCCGGG + Intronic
947248673 2:228077809-228077831 AAACTATATCATTCTGCTCCTGG - Intronic
947346519 2:229196280-229196302 AACCTATATTTCTTTTATCAAGG - Intronic
947784840 2:232807670-232807692 TACCTCATTTTTTCTTCTCCAGG + Intronic
1169300864 20:4440931-4440953 ACCTTATCTTTTTCTCCTCCTGG - Intergenic
1169636107 20:7693645-7693667 AAACTACATCTTTTTTCTCCAGG + Intergenic
1169717098 20:8632005-8632027 AACCCATATTTGTCTCCTCCAGG - Intronic
1169950960 20:11042614-11042636 AAACCATCATTTTCTTCTCCTGG + Intergenic
1170294097 20:14805759-14805781 AACATTTTTTTTTCCTCTCCTGG + Intronic
1171351856 20:24508556-24508578 CACCTATGTTTTTCTTCACTGGG - Intronic
1171525210 20:25803759-25803781 AAACCATATTATTCTGCTCCTGG - Intronic
1171543234 20:25981506-25981528 AACCTTTGTTTTTATTCTGCAGG - Intergenic
1171551617 20:26052125-26052147 AAACCATATTATTCTGCTCCTGG + Intergenic
1171571596 20:26256314-26256336 AAACCATATTTTTCCACTCCTGG - Intergenic
1171573478 20:26276278-26276300 AAACCATATTTTTCCACTCCTGG + Intergenic
1171792740 20:29543428-29543450 AAACCATATTATTCTGCTCCTGG + Intergenic
1171837387 20:30169133-30169155 AAACCATATTTTTCCACTCCTGG - Intergenic
1171846286 20:30278122-30278144 AACCTTTGTTTTTATTCTGCAGG - Intergenic
1171855730 20:30340974-30340996 AAACCATATTATTCTGCTCCTGG - Intergenic
1172211389 20:33200988-33201010 AACCTGTCCTTTCCTTCTCCTGG + Intergenic
1172792442 20:37515196-37515218 AACCTTTATATTTGTTCTTCAGG + Intronic
1174584999 20:51601601-51601623 CCCCCATAGTTTTCTTCTCCTGG - Intronic
1174642920 20:52060818-52060840 AATGTCCATTTTTCTTCTCCGGG + Intronic
1174756646 20:53165613-53165635 AAGCTTTATTTTTCTGCCCCAGG - Intronic
1177515777 21:22148988-22149010 AAACCATATTATTCTTCCCCTGG - Intergenic
1178250363 21:30998157-30998179 AACCTCCTTTTTTCTTGTCCAGG - Intergenic
1179072667 21:38086726-38086748 AACATATATTTTCCTTTTCTTGG + Intronic
1180573781 22:16753331-16753353 AAACCATATTTTTCCACTCCTGG - Intergenic
1182860848 22:33558071-33558093 AATTTATGTTTTTCTTCCCCGGG + Intronic
1182866873 22:33611720-33611742 AAACTATATCATTCCTCTCCTGG - Intronic
1184061667 22:42086535-42086557 AACCTGTATGTTTCTCCTCTTGG - Intronic
949471375 3:4400271-4400293 TTCCTATACTTTTCTTCACCTGG - Intronic
949655888 3:6218813-6218835 GACCTATCGTTTTCTTCTCCAGG + Intergenic
949742176 3:7248966-7248988 GATCTATATTTATTTTCTCCTGG - Intronic
950259451 3:11533481-11533503 AACTTTGATTTGTCTTCTCCAGG + Intronic
951008768 3:17651049-17651071 AATCTTGATTTTTCTTTTCCAGG - Intronic
951655974 3:25008885-25008907 CACTGATATTTTTCATCTCCAGG + Intergenic
951719243 3:25680169-25680191 AATCTATATATCTCTTCTTCAGG - Intergenic
952222543 3:31339649-31339671 AACCTATATCTTTCATGTCTTGG + Intergenic
952683633 3:36124118-36124140 CACTTATATTTTTCAGCTCCAGG - Intergenic
952737366 3:36704052-36704074 CAGCTCTATTTTTCTCCTCCAGG - Intergenic
953202279 3:40788124-40788146 AAACTATATCATTCTTCCCCTGG - Intergenic
953897097 3:46811258-46811280 CACCGATATTTTACGTCTCCTGG - Intronic
955771483 3:62389205-62389227 ATTCTACATTTTTCTTGTCCGGG + Intergenic
955926799 3:64014669-64014691 AACAAATATTCTCCTTCTCCAGG - Intronic
956154443 3:66280725-66280747 AACGTGTATTTTTTTTCCCCAGG + Intronic
957196876 3:77080082-77080104 TTCCTGTATTTTTCTTCTCTTGG + Intronic
957399788 3:79695024-79695046 AAACTGTATTTTTCTTCTTTTGG - Intronic
957492995 3:80953625-80953647 AACCTGTGTTTTGATTCTCCAGG - Intergenic
957493345 3:80958421-80958443 AACCTGTATTTTGATTCACCAGG - Intergenic
957493740 3:80963775-80963797 AACCTGTGTTTTTATTCACCAGG - Intergenic
958463368 3:94427057-94427079 AAACCATATTATTCTTCCCCTGG - Intergenic
958988522 3:100812794-100812816 ATCCTATATTTTTCTTCCGTAGG - Intronic
959147160 3:102562288-102562310 AATGTATATTTTTCTGCTGCTGG + Intergenic
960354174 3:116630535-116630557 AACTGAGATTTTTCTTCTCCAGG + Intronic
961267477 3:125655739-125655761 AACCTGTATTTTGATTCCCCAGG - Intergenic
961267570 3:125656918-125656940 AAGCTATATTTTGATTCACCAGG - Intergenic
961616430 3:128185925-128185947 AACATACATTTCTGTTCTCCTGG + Intronic
961962092 3:130865491-130865513 AAACCATATTATTCTGCTCCTGG - Intronic
962951847 3:140227007-140227029 AAACCATATTATTCTACTCCTGG + Intronic
963487214 3:145950163-145950185 AACATAGATTTTTCTTCCCTGGG + Intergenic
964023455 3:152042493-152042515 AACTTTTCCTTTTCTTCTCCTGG + Intergenic
964044004 3:152299383-152299405 AACCTATCTCTTTTTTCTACAGG + Exonic
964738174 3:159938025-159938047 AACCTATCATTTTCTGCTTCTGG + Intergenic
964767751 3:160195175-160195197 CACCCAGATTTTTCTGCTCCAGG + Intergenic
964884058 3:161460021-161460043 AAACCATATTATTCTTCCCCTGG - Intergenic
964894753 3:161582156-161582178 AACCTTATTTTTTATTCTCCTGG - Intergenic
965270024 3:166603119-166603141 AACCTATATTAATCTCCTACAGG - Intergenic
965921718 3:173925086-173925108 AACCTATTTTTTTCTTTTGGTGG + Intronic
965935568 3:174106001-174106023 AATCTATATTTTACTTGACCCGG + Intronic
967153062 3:186667352-186667374 AACTAAAATTTCTCTTCTCCAGG - Intronic
967547357 3:190747177-190747199 AAACTATATTTTTTTTTTCTGGG - Intergenic
969762671 4:9200723-9200745 AAACCATATTATTCTGCTCCTGG - Intergenic
970061207 4:12036604-12036626 AACCTATATATCTCCTCTCCAGG + Intergenic
970834582 4:20387187-20387209 AACCTTTATTGTTGTTCTCAGGG + Intronic
971366102 4:25978239-25978261 AACCAGTACTTTGCTTCTCCTGG - Intergenic
971517662 4:27508979-27509001 AACATATATTTATTTTCTCGAGG + Intergenic
971598862 4:28567753-28567775 AAACCATATCATTCTTCTCCTGG + Intergenic
972002573 4:34057848-34057870 AAACTATATCATTCTGCTCCTGG + Intergenic
972004994 4:34090438-34090460 CTCCTATCTTTTTCTTCTCTCGG + Intergenic
972109451 4:35539184-35539206 AACATATATTTTTTCTCTCAAGG - Intergenic
972502124 4:39688044-39688066 AATCTGCATTTTTATTCTCCAGG - Intergenic
972943912 4:44229693-44229715 AGCCTTTTTTTTTCTTCTTCAGG + Intronic
974842239 4:67311224-67311246 AAGCCATATTATTCTGCTCCAGG - Intergenic
975196827 4:71535439-71535461 AGCTTTTAATTTTCTTCTCCTGG - Intronic
975435168 4:74343570-74343592 AAACTATATTATTCTTCCCCTGG + Intergenic
977244061 4:94608657-94608679 CAGCTAATTTTTTCTTCTCCAGG - Intronic
978055395 4:104257436-104257458 AACCTATTTTTTAATTTTCCTGG - Intergenic
978160739 4:105545039-105545061 AATCTATATTTTTTCTTTCCAGG + Intergenic
978983891 4:114984617-114984639 AACTTATATTTATATTTTCCAGG + Intronic
979100055 4:116601807-116601829 GGCCTTTATTTTTCTTCTACTGG + Intergenic
979397682 4:120208006-120208028 AAGCTATATTATTCTTCTCCTGG + Intergenic
979833089 4:125325418-125325440 AACATATATTGTTGTTTTCCTGG + Intronic
980299258 4:130966051-130966073 AAACTATATCATTCTGCTCCTGG - Intergenic
980351746 4:131692964-131692986 AAACTATATTATTCTTCCCATGG + Intergenic
980808161 4:137840204-137840226 AATATTTATTTTTCTTTTCCAGG - Intergenic
980902589 4:138919150-138919172 AATATATATTTTTCATTTCCGGG + Intergenic
981400803 4:144312062-144312084 AACTTATATTTTTGTTTTACAGG + Intergenic
981465462 4:145065974-145065996 CACCTAGATTTTTTTTTTCCTGG - Intronic
981798367 4:148626215-148626237 CCCCTATTTTTTTCTTCTACGGG - Intergenic
982515446 4:156341975-156341997 AACCTATATATCTCTTTTCCAGG - Intergenic
982949657 4:161675647-161675669 AAACTATATTTTTCTCCTGAAGG + Intronic
983117687 4:163839372-163839394 AACCTATATTTTTATATTCTTGG - Intronic
983157323 4:164365867-164365889 GCCTTATATTTTTCTTCTCAAGG - Intronic
984175754 4:176414568-176414590 TATATATATTTTTCTTCTCAAGG + Intergenic
984248486 4:177304049-177304071 AACCTACATTTTTTTGCTCCTGG - Intergenic
984268062 4:177517710-177517732 AACCTTTATTTAGCTTCTACGGG + Intergenic
985684543 5:1275005-1275027 AACCTCCGTTTTCCTTCTCCAGG - Intronic
987497597 5:18668474-18668496 AAAATATACTTTTCTTCTTCTGG + Intergenic
987565110 5:19574289-19574311 AATATATATTTTACTACTCCAGG + Intronic
987872571 5:23639917-23639939 AAACTATAGTTCTCTTCTCCTGG + Intergenic
987892315 5:23895365-23895387 AACCCATGTTTTTTTTCACCAGG + Intergenic
987892582 5:23899462-23899484 AACCTGTGTTTTTATTCACCAGG + Intergenic
987892655 5:23901172-23901194 AACCTGTATTTTTATTCAACAGG + Intergenic
987985915 5:25145406-25145428 AAAATATATTTTTTCTCTCCTGG + Intergenic
989725860 5:44585579-44585601 AATCTATTTTTATCTTCTCTCGG + Intergenic
989753199 5:44920555-44920577 AAGATAAATTATTCTTCTCCAGG + Intergenic
990311766 5:54547080-54547102 TACATATATGTTTTTTCTCCTGG + Intergenic
990906558 5:60809806-60809828 ATCCTAATTTTTTTTTCTCCAGG + Intronic
992278486 5:75147122-75147144 AACCAATCTGTTTATTCTCCTGG + Exonic
993200905 5:84813606-84813628 AAACCATATTTTTCTGCCCCTGG - Intergenic
993357164 5:86928703-86928725 AAAAAATATTTTTTTTCTCCAGG + Intergenic
993413089 5:87595900-87595922 AAACCATATTATTCTGCTCCTGG + Intergenic
993806112 5:92412071-92412093 AACAAATATTTCTCTTTTCCTGG + Intergenic
994432092 5:99679364-99679386 ATTCTAGCTTTTTCTTCTCCAGG - Intergenic
994580266 5:101632617-101632639 AACCTATTTTTCTCTTATACTGG + Intergenic
995181574 5:109235155-109235177 AACCTATATCATTCTGCTCCTGG - Intergenic
995425209 5:112013687-112013709 AACCTACATTTTCATTCTCTTGG - Intergenic
996575543 5:124973259-124973281 AACCTAAATTTTTGTTGTCGCGG + Intergenic
997131564 5:131282538-131282560 AACCTTTTTTTTTCTTCTTTGGG + Intronic
997746994 5:136308080-136308102 AAGTTCTATTTTCCTTCTCCTGG + Intronic
999476306 5:151902082-151902104 AACCTATATTTTCCAATTCCCGG - Intronic
1000220092 5:159207230-159207252 AACCTACATTTTTCTTATTCAGG - Intronic
1000250410 5:159489366-159489388 AAGCAAGATCTTTCTTCTCCAGG - Intergenic
1000978314 5:167789207-167789229 AATCCATATTTTTCTTTTCCTGG + Intronic
1001359598 5:171068525-171068547 AAATTATATTTTTCCTCCCCAGG + Intronic
1003088435 6:3080689-3080711 AATATATATTTTTGTTCTCAAGG + Intronic
1003444981 6:6175865-6175887 AAGCTATGTTTTTCTTCTTCTGG - Intronic
1004373135 6:15069654-15069676 AAACAATGTTTATCTTCTCCTGG - Intergenic
1004430387 6:15537544-15537566 AAACTATATTATTCTGCCCCAGG - Intronic
1004926847 6:20424146-20424168 ATTCTATATATTTTTTCTCCTGG + Intronic
1005176214 6:23047482-23047504 GAGCTCTCTTTTTCTTCTCCTGG + Intergenic
1005445056 6:25914413-25914435 AGCTTATATTTTTCTTCCTCTGG + Intronic
1005795267 6:29353770-29353792 ACCCTAAATAATTCTTCTCCAGG - Intergenic
1005877368 6:30021761-30021783 TACCTATTTTTTTTTTCTCAAGG - Intergenic
1006571080 6:35005029-35005051 AACTCATTTTTTCCTTCTCCAGG + Intronic
1007063562 6:38965843-38965865 AATCAATCTTTTTCTTCCCCAGG + Intronic
1008114106 6:47527616-47527638 ATGCTATCTTTTTCTTCTACTGG - Intronic
1008334738 6:50288790-50288812 ATCTTATTATTTTCTTCTCCAGG + Intergenic
1009554343 6:65143039-65143061 AACATACATTTTTCCCCTCCTGG - Intronic
1009586749 6:65617193-65617215 AAACAATATTTTTTTTCTCCAGG - Intronic
1010452084 6:76014653-76014675 ATCATCCATTTTTCTTCTCCAGG + Intronic
1011236834 6:85227747-85227769 AAACCATATTATTCTGCTCCTGG + Intergenic
1011443528 6:87412565-87412587 ACCCTTGATATTTCTTCTCCTGG - Intronic
1012010523 6:93778636-93778658 TATGTATATTTTTCTTCTTCTGG - Intergenic
1014225406 6:118841225-118841247 AACTTATATTTTTCACATCCTGG + Intronic
1014535490 6:122608949-122608971 AACATATATTTTTATTATCTAGG - Intronic
1014804670 6:125815524-125815546 AAAGTATAGTTTACTTCTCCTGG - Intronic
1014857292 6:126417454-126417476 AAACTATATCATTCTTCCCCTGG - Intergenic
1015041443 6:128725138-128725160 ACTGTATATTTTTTTTCTCCAGG + Intergenic
1015709022 6:136119425-136119447 AACCTTTATTTTTCTTCCAAAGG + Intronic
1016745449 6:147574407-147574429 AACCTTTATTTATCTTCTGTAGG + Intronic
1017085669 6:150710685-150710707 AACCTAGATTTTTTTTTTCTGGG - Intronic
1017275798 6:152566483-152566505 AACCTATATTTTGCTGCTCTTGG - Intronic
1017342155 6:153336390-153336412 AAACCATATCTTTCTGCTCCTGG - Intergenic
1017689878 6:156953435-156953457 AAACTATTTTTATTTTCTCCTGG + Intronic
1017962848 6:159236635-159236657 AACTTATATTTTCCCTGTCCTGG + Intronic
1018083842 6:160284042-160284064 ACTCTGTATTTTTCTTCTTCAGG + Intergenic
1018274036 6:162111036-162111058 GACATCTGTTTTTCTTCTCCCGG - Intronic
1018290787 6:162290767-162290789 AATTTGTATTTTCCTTCTCCTGG - Intronic
1018466002 6:164045605-164045627 AACTGCTTTTTTTCTTCTCCAGG - Intergenic
1020662509 7:10998596-10998618 TATGTGTATTTTTCTTCTCCAGG + Intronic
1020876779 7:13705975-13705997 AATCTTTATTTTTATACTCCAGG - Intergenic
1021425115 7:20490882-20490904 AACCTGTATTATTCTTCTCCTGG - Intergenic
1022433151 7:30347800-30347822 AATCTAGATTTATATTCTCCAGG + Intronic
1022511983 7:30942107-30942129 ATCCTTTCTTTTTCATCTCCAGG + Intronic
1022595628 7:31710996-31711018 CACCTATCCTTTTCTTCTTCAGG - Intergenic
1022617360 7:31945361-31945383 AACCTGTATCATTGTTCTCCTGG + Intronic
1023196700 7:37648095-37648117 AGCCTGTATTTTTCTTCTAATGG - Intergenic
1023364511 7:39450460-39450482 ATCATTTTTTTTTCTTCTCCGGG - Intronic
1023523913 7:41078578-41078600 AAGCTACATTGTTCTTTTCCAGG + Intergenic
1024211986 7:47213929-47213951 AACCTCCATTTTTGTTCTCAAGG + Intergenic
1025038675 7:55620010-55620032 AACCCATATCCTTCTTCTCCTGG - Intergenic
1025300268 7:57814405-57814427 AAACCATATTATTCTGCTCCTGG + Intergenic
1025533498 7:61919510-61919532 AACCTTTATTTTTATTCAGCAGG + Intergenic
1026779258 7:73253326-73253348 ATCGGATATTTTGCTTCTCCTGG - Intergenic
1027020117 7:74806732-74806754 ATCGGATATTTTGCTTCTCCTGG - Intronic
1027067909 7:75139207-75139229 ATCGGATATTTTGCTTCTCCTGG + Intronic
1027598817 7:80212349-80212371 AACCTCTATTTATCTTCTAATGG + Intronic
1031542500 7:123011700-123011722 AAAATATATTTTTTTTCTCAAGG - Intergenic
1033409229 7:141101864-141101886 ACCCTCTATTTTTTTTCTTCAGG + Intronic
1033474962 7:141683205-141683227 ATTCTGTTTTTTTCTTCTCCAGG - Intronic
1033550471 7:142442420-142442442 AATCTGTATTTTTTTTCTTCTGG + Intergenic
1033651501 7:143346889-143346911 GACCTATGTCTTTCTTCTCTAGG + Exonic
1035855251 8:2967744-2967766 AAAATATATCTTTGTTCTCCAGG - Intronic
1035923271 8:3701196-3701218 AACCTGCATTTCTCTTCTACGGG - Intronic
1036272766 8:7322458-7322480 AAACCATATTATTCTGCTCCTGG - Intergenic
1036348584 8:7987890-7987912 AAACCATATTATTCTGCTCCTGG + Intergenic
1036457590 8:8923597-8923619 AAACCATATTATTCTGCTCCTGG + Intergenic
1036769648 8:11570304-11570326 AACCTTTTTCTTTCTTCCCCTGG + Intergenic
1036843855 8:12148358-12148380 AAACCATATTATTCTGCTCCTGG + Intergenic
1036865224 8:12390679-12390701 AAACCATATTATTCTGCTCCTGG + Intergenic
1036967304 8:13314959-13314981 AACCTATATTTTACTGATCCTGG - Intronic
1037138040 8:15486768-15486790 AGCCTATATTTTCCTTTTACTGG + Intronic
1037223756 8:16557582-16557604 AAACATTATTTTTCTTATCCAGG - Intronic
1038054334 8:23843909-23843931 TAGCTTTATTTTTCTTTTCCTGG - Exonic
1038356198 8:26831696-26831718 AAACTATGTTCTTCTTGTCCTGG - Intronic
1038773555 8:30506913-30506935 AACCAATTTCCTTCTTCTCCAGG - Intronic
1039140447 8:34381574-34381596 AACCAAGATTTTTTTTCTTCAGG + Intergenic
1039769637 8:40671324-40671346 AACATATGTTTTACTTCTCTTGG - Intronic
1040135654 8:43850628-43850650 AACCTTTCTTTTTATTCTGCAGG + Intergenic
1040297877 8:46171287-46171309 AACCTTTATTTTTATTCAGCAGG - Intergenic
1040332590 8:46396792-46396814 AACCTATGTTTTCATTCACCAGG - Intergenic
1040454404 8:47581662-47581684 AATCTACATTTTTCTTTTCATGG - Intronic
1040645125 8:49388710-49388732 AAACTATATTATTCTGCCCCTGG - Intergenic
1040696421 8:50005186-50005208 AATGTATATTTTTCTTCTTTAGG - Intronic
1040910771 8:52516416-52516438 AGCCTAAATTTTTATTCTTCAGG - Intergenic
1041342462 8:56860016-56860038 TCCCTGTATTTTTCTTATCCAGG + Intergenic
1042399710 8:68331306-68331328 GACCGATCTTGTTCTTCTCCAGG - Exonic
1042466240 8:69132731-69132753 AAACTATATCATTCTGCTCCTGG + Intergenic
1043005417 8:74812079-74812101 AAAATATATTTTTCTTTTCCAGG - Intronic
1043444761 8:80308372-80308394 GATCTCTTTTTTTCTTCTCCGGG + Intergenic
1043496689 8:80808958-80808980 AAACTGTATTTTTGTTCTTCGGG - Intronic
1044412954 8:91904419-91904441 AACCTATCTTTTCCTCCTGCTGG + Intergenic
1044619968 8:94179845-94179867 ATCATATATCTTTCTTTTCCTGG - Intronic
1045733226 8:105266054-105266076 GTCATATATTTTTGTTCTCCAGG + Intronic
1045791443 8:105988787-105988809 AAACTATATCATTCTGCTCCTGG - Intergenic
1046615279 8:116470744-116470766 AAACTGTATTTTTCTTCCACAGG + Intergenic
1046641210 8:116733914-116733936 AAACTATGTTTCTCCTCTCCTGG - Intronic
1047260578 8:123255549-123255571 AACTTAAAATTCTCTTCTCCTGG + Exonic
1047947699 8:129898689-129898711 AAAACATATTTTTCTTCTCTTGG + Intronic
1048286145 8:133143177-133143199 ATGCTATGTTTTCCTTCTCCAGG - Intergenic
1048859904 8:138716512-138716534 AACCCTTATTTTGCCTCTCCTGG + Intronic
1048939612 8:139387153-139387175 ATCCTATTTTTTTCTTATCTTGG - Intergenic
1049927908 9:427483-427505 AAGCTATATTTTTCTACAGCAGG - Intronic
1050074955 9:1853670-1853692 AAACCATATCATTCTTCTCCTGG - Intergenic
1051023615 9:12577410-12577432 AACCTATATTTTTTTTCCTTGGG + Intergenic
1051345909 9:16151169-16151191 CACCTGTGTTTTTATTCTCCTGG - Intergenic
1051352465 9:16211162-16211184 GGCCTATAATTTTCTTCTCCTGG + Intronic
1051782110 9:20700650-20700672 AACATTTATTTTTCTACTTCTGG + Intronic
1051843757 9:21428543-21428565 GGCCTTTCTTTTTCTTCTCCTGG + Intronic
1052030218 9:23620038-23620060 ATCCTATTTTTATCATCTCCAGG + Intergenic
1052125507 9:24769890-24769912 AAAATATAGTTTTCTTCTTCGGG + Intergenic
1052781593 9:32786159-32786181 AATTCATATTTTTCTTCACCGGG - Exonic
1053793550 9:41704267-41704289 AAACCATATTATTCTGCTCCTGG - Intergenic
1054151628 9:61610563-61610585 AAACCATATTATTCTGCTCCTGG + Intergenic
1054161798 9:61677691-61677713 AACCTTTGTTTTTATTCTGCAGG + Intergenic
1054181960 9:61916282-61916304 AAACCATATTATTCTGCTCCTGG - Intergenic
1055158410 9:73094256-73094278 AACTTGTATTCTTTTTCTCCAGG - Intergenic
1056674416 9:88662219-88662241 GATCTATATTTTTCTTCTCAGGG - Intergenic
1058733368 9:107871772-107871794 AATGTATATATTTCTTCTACAGG + Intergenic
1058774831 9:108272948-108272970 ACCCTGTGTTTTTCTTCCCCTGG + Intergenic
1060492171 9:124093000-124093022 CACCTGGCTTTTTCTTCTCCTGG + Intergenic
1186378170 X:9030890-9030912 AACCTAAATTTTTATACTCATGG - Intronic
1186553867 X:10536293-10536315 AATCTATTTTTTTTTTCCCCAGG - Intronic
1187140677 X:16590532-16590554 TACTTATATTTTTTTTTTCCTGG + Intronic
1190949151 X:55125256-55125278 ATCATATATTTTTCTTCGTCAGG + Intronic
1191228865 X:58078237-58078259 AGCCTATGTTTTTATTCTCGAGG - Intergenic
1191231009 X:58094596-58094618 AACCTGTATTTTCATTCACCAGG + Intergenic
1191231019 X:58094768-58094790 AACCTGTGTTTTTATTCTCCAGG + Intergenic
1191231091 X:58095898-58095920 AACCTGTATTTTGATTCACCAGG + Intergenic
1191231146 X:58096718-58096740 AACCTATGTTTTGATTCACCTGG + Intergenic
1191237554 X:58146697-58146719 AACCTATGTTTTGATTCACCAGG + Intergenic
1191240303 X:58184328-58184350 AACCTGTATTTTGATTCACCAGG + Intergenic
1191244691 X:58217061-58217083 AACCTGTGTTTTTATTCACCAGG + Intergenic
1191583202 X:62788794-62788816 AACCTATCTTTTGATTCTGCAGG - Intergenic
1191952347 X:66606242-66606264 AACCTATTCTTTATTTCTCCTGG + Intronic
1193642866 X:84033436-84033458 ATACTAAATTGTTCTTCTCCAGG - Intergenic
1193706933 X:84832639-84832661 AACCTGTATTTTTCTGTTTCTGG + Intergenic
1193758456 X:85437119-85437141 AAACTATATTATTCTGCCCCTGG - Intergenic
1194273994 X:91857362-91857384 AAACCATATTTTTCTGCCCCTGG + Intronic
1194363428 X:92983841-92983863 AACCCGTATTTTTCCTCTACTGG + Intergenic
1194920757 X:99761135-99761157 AACCCACATTATTCTGCTCCTGG - Intergenic
1195728226 X:107939050-107939072 ATGCTCTATTTTTCATCTCCTGG - Intergenic
1196168814 X:112565015-112565037 AAACCATATTATTCTGCTCCTGG + Intergenic
1196567830 X:117229730-117229752 AAACTATATCATTCTTCCCCTGG + Intergenic
1196893753 X:120313048-120313070 AAGCTTTGTTTTTCTTATCCAGG + Intergenic
1197056661 X:122128901-122128923 AAACTATATCATTCTTCTGCTGG - Intergenic
1197061252 X:122184309-122184331 AAACTATATCATTCTTCTCCTGG + Intergenic
1197130054 X:122994949-122994971 AACATTTAATTTTCTTCTTCAGG + Intergenic
1197289999 X:124643770-124643792 CACTTAAATTTGTCTTCTCCGGG - Intronic
1198377723 X:136055603-136055625 AACATATATTTTCATTCTTCTGG - Intergenic
1199275192 X:145933244-145933266 ATCATTTATTTTTCTTCTCTAGG - Intergenic
1200591231 Y:5078779-5078801 AAACCATATTTTTCTGCCCCTGG + Intronic
1200671664 Y:6100100-6100122 AACCCATATTTTTCCTCTACTGG + Intergenic
1200875654 Y:8151893-8151915 AAACAATAATTTTCTACTCCAGG + Intergenic
1201775670 Y:17662714-17662736 AACCTATCTTTTGATTCTGCAGG - Intergenic
1201825886 Y:18243275-18243297 AACCTATCTTTTGATTCTGCAGG + Intergenic
1202075310 Y:21031642-21031664 AAGCTGTGTTTTTCTTCTGCTGG - Intergenic