ID: 1097289638

View in Genome Browser
Species Human (GRCh38)
Location 12:57903786-57903808
Sequence CAGCAGTCTCTTGGGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097289638_1097289644 14 Left 1097289638 12:57903786-57903808 CCAACCAACCCAAGAGACTGCTG No data
Right 1097289644 12:57903823-57903845 TGTGAGACTTCCTAAGAGCCTGG No data
1097289638_1097289645 17 Left 1097289638 12:57903786-57903808 CCAACCAACCCAAGAGACTGCTG No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data
1097289638_1097289643 -9 Left 1097289638 12:57903786-57903808 CCAACCAACCCAAGAGACTGCTG No data
Right 1097289643 12:57903800-57903822 AGACTGCTGAGCAGGAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097289638 Original CRISPR CAGCAGTCTCTTGGGTTGGT TGG (reversed) Intergenic