ID: 1097289639

View in Genome Browser
Species Human (GRCh38)
Location 12:57903790-57903812
Sequence TGCTCAGCAGTCTCTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097289639_1097289645 13 Left 1097289639 12:57903790-57903812 CCAACCCAAGAGACTGCTGAGCA No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data
1097289639_1097289644 10 Left 1097289639 12:57903790-57903812 CCAACCCAAGAGACTGCTGAGCA No data
Right 1097289644 12:57903823-57903845 TGTGAGACTTCCTAAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097289639 Original CRISPR TGCTCAGCAGTCTCTTGGGT TGG (reversed) Intergenic
No off target data available for this crispr