ID: 1097289639 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:57903790-57903812 |
Sequence | TGCTCAGCAGTCTCTTGGGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1097289639_1097289645 | 13 | Left | 1097289639 | 12:57903790-57903812 | CCAACCCAAGAGACTGCTGAGCA | No data | ||
Right | 1097289645 | 12:57903826-57903848 | GAGACTTCCTAAGAGCCTGGAGG | No data | ||||
1097289639_1097289644 | 10 | Left | 1097289639 | 12:57903790-57903812 | CCAACCCAAGAGACTGCTGAGCA | No data | ||
Right | 1097289644 | 12:57903823-57903845 | TGTGAGACTTCCTAAGAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1097289639 | Original CRISPR | TGCTCAGCAGTCTCTTGGGT TGG (reversed) | Intergenic | ||