ID: 1097289641

View in Genome Browser
Species Human (GRCh38)
Location 12:57903794-57903816
Sequence CTCCTGCTCAGCAGTCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097289641_1097289645 9 Left 1097289641 12:57903794-57903816 CCCAAGAGACTGCTGAGCAGGAG No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data
1097289641_1097289644 6 Left 1097289641 12:57903794-57903816 CCCAAGAGACTGCTGAGCAGGAG No data
Right 1097289644 12:57903823-57903845 TGTGAGACTTCCTAAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097289641 Original CRISPR CTCCTGCTCAGCAGTCTCTT GGG (reversed) Intergenic