ID: 1097289643

View in Genome Browser
Species Human (GRCh38)
Location 12:57903800-57903822
Sequence AGACTGCTGAGCAGGAGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097289635_1097289643 26 Left 1097289635 12:57903751-57903773 CCAAGCTAAGGAAAATGGGGATG No data
Right 1097289643 12:57903800-57903822 AGACTGCTGAGCAGGAGAAGCGG No data
1097289636_1097289643 -4 Left 1097289636 12:57903781-57903803 CCCTGCCAACCAACCCAAGAGAC No data
Right 1097289643 12:57903800-57903822 AGACTGCTGAGCAGGAGAAGCGG No data
1097289637_1097289643 -5 Left 1097289637 12:57903782-57903804 CCTGCCAACCAACCCAAGAGACT No data
Right 1097289643 12:57903800-57903822 AGACTGCTGAGCAGGAGAAGCGG No data
1097289638_1097289643 -9 Left 1097289638 12:57903786-57903808 CCAACCAACCCAAGAGACTGCTG No data
Right 1097289643 12:57903800-57903822 AGACTGCTGAGCAGGAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097289643 Original CRISPR AGACTGCTGAGCAGGAGAAG CGG Intergenic