ID: 1097289645

View in Genome Browser
Species Human (GRCh38)
Location 12:57903826-57903848
Sequence GAGACTTCCTAAGAGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097289637_1097289645 21 Left 1097289637 12:57903782-57903804 CCTGCCAACCAACCCAAGAGACT No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data
1097289638_1097289645 17 Left 1097289638 12:57903786-57903808 CCAACCAACCCAAGAGACTGCTG No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data
1097289639_1097289645 13 Left 1097289639 12:57903790-57903812 CCAACCCAAGAGACTGCTGAGCA No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data
1097289642_1097289645 8 Left 1097289642 12:57903795-57903817 CCAAGAGACTGCTGAGCAGGAGA No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data
1097289636_1097289645 22 Left 1097289636 12:57903781-57903803 CCCTGCCAACCAACCCAAGAGAC No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data
1097289641_1097289645 9 Left 1097289641 12:57903794-57903816 CCCAAGAGACTGCTGAGCAGGAG No data
Right 1097289645 12:57903826-57903848 GAGACTTCCTAAGAGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097289645 Original CRISPR GAGACTTCCTAAGAGCCTGG AGG Intergenic
No off target data available for this crispr