ID: 1097291721

View in Genome Browser
Species Human (GRCh38)
Location 12:57922264-57922286
Sequence TCCAGGACGTTGAGACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097291714_1097291721 17 Left 1097291714 12:57922224-57922246 CCCAGCACTTCGGGAGGCCAAGG 0: 1622
1: 89495
2: 214820
3: 238809
4: 160623
Right 1097291721 12:57922264-57922286 TCCAGGACGTTGAGACCAGCTGG No data
1097291716_1097291721 16 Left 1097291716 12:57922225-57922247 CCAGCACTTCGGGAGGCCAAGGT 0: 490
1: 29986
2: 127065
3: 225505
4: 207915
Right 1097291721 12:57922264-57922286 TCCAGGACGTTGAGACCAGCTGG No data
1097291719_1097291721 0 Left 1097291719 12:57922241-57922263 CCAAGGTGAAAGGATGGCTTCAG No data
Right 1097291721 12:57922264-57922286 TCCAGGACGTTGAGACCAGCTGG No data
1097291712_1097291721 25 Left 1097291712 12:57922216-57922238 CCAGTAATCCCAGCACTTCGGGA 0: 4899
1: 294023
2: 265853
3: 205200
4: 295969
Right 1097291721 12:57922264-57922286 TCCAGGACGTTGAGACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097291721 Original CRISPR TCCAGGACGTTGAGACCAGC TGG Intergenic
No off target data available for this crispr