ID: 1097293468

View in Genome Browser
Species Human (GRCh38)
Location 12:57940072-57940094
Sequence ATAGTATTTCAAATGTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097293466_1097293468 20 Left 1097293466 12:57940029-57940051 CCTGAATCTATGTATTAAAAAAG 0: 1
1: 0
2: 3
3: 38
4: 441
Right 1097293468 12:57940072-57940094 ATAGTATTTCAAATGTATATAGG 0: 1
1: 0
2: 0
3: 39
4: 461
1097293465_1097293468 23 Left 1097293465 12:57940026-57940048 CCACCTGAATCTATGTATTAAAA 0: 1
1: 0
2: 6
3: 31
4: 371
Right 1097293468 12:57940072-57940094 ATAGTATTTCAAATGTATATAGG 0: 1
1: 0
2: 0
3: 39
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097293468 Original CRISPR ATAGTATTTCAAATGTATAT AGG Intergenic
901269089 1:7936663-7936685 ATTGTATTTCAAAAGTGTATTGG - Intronic
904517639 1:31068740-31068762 ATGGTATATGAAATATATATCGG + Intergenic
907965682 1:59326504-59326526 TCAGTTTTTCAAATGTAAATGGG - Intronic
908587961 1:65594615-65594637 ATTGTATTTGAGATGTCTATTGG + Intronic
908697524 1:66860643-66860665 AGAGTATTTCATGTGTGTATGGG - Intronic
909151072 1:72006106-72006128 ATTTTATTTCAAATATATGTGGG - Intronic
909463706 1:75948588-75948610 ATAATATTTTACATGTATATGGG - Intergenic
909657557 1:78047500-78047522 ATAATACTTCACATTTATATAGG + Intronic
909889805 1:80990830-80990852 AAAATGTTTCAAACGTATATTGG + Intergenic
910128662 1:83875720-83875742 ACACTTTTTCAAATGTTTATTGG + Intronic
911198786 1:95022996-95023018 ATAGTATATAAAATTTTTATTGG - Intronic
911608022 1:99930382-99930404 ATAGAATTCCAAATATATAACGG - Intergenic
911824816 1:102469088-102469110 ATACTTTTTAATATGTATATTGG + Intergenic
911848604 1:102785257-102785279 AAACTATTTTAAATGTATTTTGG + Intergenic
912209327 1:107541340-107541362 ATAGTGTCTCAAATGCATGTTGG - Intergenic
912399799 1:109380650-109380672 ATAGCTTTTCAAATGTTTATTGG - Intronic
912997479 1:114545654-114545676 TTATTTTTTCAAATGAATATTGG - Intergenic
913523976 1:119673549-119673571 ATTGAATTTCACATGTACATTGG - Intronic
914772440 1:150700915-150700937 ATAGTTATTAAAATGAATATTGG + Intronic
915868541 1:159532683-159532705 AAAGTATTTGAAATGTACAAAGG + Intergenic
915966086 1:160309562-160309584 ATAGGAATGCAAATGTTTATTGG + Intronic
916865504 1:168852731-168852753 GAAGTTTCTCAAATGTATATAGG + Intergenic
918117966 1:181512881-181512903 ATAGTATTACAGAACTATATTGG + Intronic
918674595 1:187267166-187267188 ATCGTATTTGAAATGGCTATTGG + Intergenic
918753393 1:188303462-188303484 TTAATATTTCAAATGATTATGGG - Intergenic
918841139 1:189541053-189541075 ATAGTATTTCAAAACTGTTTTGG + Intergenic
919234541 1:194823441-194823463 ATAGTATTTTACATATTTATGGG - Intergenic
919535067 1:198777095-198777117 TTAGTATCTCAAATTTAGATTGG + Intergenic
920582249 1:207121728-207121750 ATATAAATTTAAATGTATATAGG - Intronic
921113402 1:212062108-212062130 ATAGTATTTTACATATTTATGGG - Intronic
922295337 1:224245102-224245124 ATAATATTTCAGATGTTAATAGG + Intronic
922965348 1:229686221-229686243 ATAGTATTTGAAATATAGCTTGG - Intergenic
923954851 1:239004786-239004808 ATAATATTAAAAATGTTTATAGG + Intergenic
924185866 1:241489777-241489799 ATACTCTTTCAAATGTATACTGG + Intergenic
924349033 1:243097449-243097471 ATAACATTTCAAATGTAACTAGG - Intergenic
1063260305 10:4380794-4380816 TTAGAATTACAAATATATATTGG - Intergenic
1063268919 10:4485427-4485449 ACACTATTCCAAATGTATATGGG - Intergenic
1063791786 10:9457840-9457862 AATGTATTTAAAATATATATTGG - Intergenic
1064997814 10:21311971-21311993 ATAATATTTTACATGTTTATGGG + Intergenic
1065197989 10:23285521-23285543 ATAATATTTTGAATATATATTGG - Intronic
1065731679 10:28715039-28715061 AAAATATATCAAATTTATATTGG - Intergenic
1065936423 10:30524345-30524367 GTATTATTTGAAATGTACATAGG - Intergenic
1066621582 10:37358589-37358611 ATCTTATTACAAATGGATATTGG - Intronic
1067073417 10:43155612-43155634 AAAGTATTTCAATTGGAAATGGG + Exonic
1067159395 10:43810598-43810620 AGAGTATTGCAAAGGTACATAGG + Intergenic
1068160793 10:53260956-53260978 ATAATATTTCAGATAAATATTGG - Intergenic
1068385648 10:56323622-56323644 ATAGTACTACAATTGTATCTTGG + Intergenic
1068946647 10:62736216-62736238 ATACTATTTCATAGATATATTGG + Intergenic
1069128540 10:64669356-64669378 ATAATATTTTACATATATATGGG + Intergenic
1069227798 10:65965950-65965972 ATAATATTTGATATCTATATTGG - Intronic
1071032482 10:81201707-81201729 ATATTATTTCAAATATGTACTGG + Intergenic
1071182245 10:83000481-83000503 AGAATATTTCAACTTTATATGGG - Intergenic
1071842250 10:89484779-89484801 CTAGTATTTCCAATTTACATAGG - Intronic
1072340885 10:94448336-94448358 AGAGTATTTGAAAAGTTTATTGG + Intronic
1072365859 10:94708611-94708633 ATTGTATTTAAAATGTATGAGGG - Intronic
1072610812 10:97016794-97016816 ATAGTTTTTAGAATGTATCTGGG + Intronic
1072708708 10:97701420-97701442 ATGGAAATTCAAATGTATATAGG + Intergenic
1073505452 10:103984259-103984281 CTAATATTTCCAATTTATATAGG + Intronic
1074091085 10:110256637-110256659 TAAGCATTTCACATGTATATTGG - Intronic
1075017915 10:118924548-118924570 ATAGTATCCCAAATGTTTAGGGG + Intergenic
1075829086 10:125389444-125389466 ATATTTCTTCAAATGTATTTTGG + Intergenic
1078959988 11:16253732-16253754 ATGGTATATCATATGTATAATGG + Intronic
1079561108 11:21820941-21820963 CTAGTATTTCAATTATACATAGG - Intergenic
1079666798 11:23116214-23116236 ATAGTCTTTCAAGTGTATGGTGG - Intergenic
1079857215 11:25621184-25621206 ATAGTATGTAAAATAAATATAGG + Intergenic
1079891134 11:26054681-26054703 AGAGTAATTTAAATTTATATAGG + Intergenic
1079948581 11:26773396-26773418 ATAGTATATCAAATTTTCATGGG + Intergenic
1080358471 11:31482579-31482601 GTACTTTTTCATATGTATATTGG - Intronic
1080546458 11:33323787-33323809 ATGGCATTTCAGATGTAGATTGG + Intronic
1081381274 11:42418464-42418486 ATAAAATTTCAAAAGTACATTGG - Intergenic
1082204916 11:49421482-49421504 ACATTATATCAAATGTGTATAGG - Intergenic
1082217768 11:49595539-49595561 ATAGTACTTCAAATGTGTTCTGG + Intergenic
1083648688 11:64187619-64187641 ATAATATTTCAGTTGTATCTAGG + Intronic
1085048088 11:73364802-73364824 ATAAGATTCCTAATGTATATGGG - Intronic
1085300241 11:75453766-75453788 ATAGCATCTCAAATGAATAAAGG + Intronic
1085406154 11:76263595-76263617 AAAGGATTTTAAATGTATAGAGG - Intergenic
1085817358 11:79753841-79753863 ATAATATTTCACATATTTATGGG - Intergenic
1085992796 11:81870785-81870807 ATAGTATTCCAAATGGAAAGAGG + Intergenic
1086319846 11:85633626-85633648 AAATTATTTTAAATGTATCTGGG + Intronic
1086386571 11:86315006-86315028 ATACTATGTCATATGTATAAAGG - Intronic
1086631805 11:89028611-89028633 ATAGTACTTCAAATGTGTTTTGG - Intronic
1087206210 11:95398020-95398042 ATAATATTTAAAAAGAATATCGG + Intergenic
1087347076 11:96984944-96984966 ATGGGCTTTCAAATGTGTATAGG - Intergenic
1087554691 11:99701629-99701651 ATAATATTTTAAAAATATATAGG - Intronic
1087873177 11:103324972-103324994 ATATTTTTTCATATGTTTATTGG + Intronic
1088086100 11:105982411-105982433 ATACTATTTCAACTGAAGATGGG + Intergenic
1088542967 11:110932329-110932351 TTAGTAATTAAAATGTAGATTGG + Intergenic
1088801286 11:113309394-113309416 ATAGTATTCCAAGTGTGTATGGG + Intergenic
1091168567 11:133501463-133501485 ATATTATTTCAAATGTTTGTTGG - Intronic
1091570914 12:1685034-1685056 ATAATATTTCAAAGTTATAAAGG - Intergenic
1092736853 12:11591281-11591303 ATACTAATTCAAATGTTTATTGG + Intergenic
1092758457 12:11787074-11787096 TTAGTATTTCAAATGTCTCGTGG + Intronic
1093682534 12:22018905-22018927 AAAGTATTTCAAATAAATTTTGG + Intergenic
1093836237 12:23832474-23832496 ATAATATTAAAAATGTATAAAGG + Intronic
1094777594 12:33749016-33749038 AAAGTATTTTCTATGTATATTGG - Intergenic
1095365465 12:41399432-41399454 ATAGGGTTTTAAAAGTATATTGG + Intronic
1095785466 12:46104353-46104375 TTACTCTTTCAGATGTATATAGG + Intergenic
1097293468 12:57940072-57940094 ATAGTATTTCAAATGTATATAGG + Intergenic
1097559655 12:61187247-61187269 AATGTATTTCAATTGTATCTTGG + Intergenic
1098056358 12:66510078-66510100 AAATTATTTAAAATGCATATGGG - Intronic
1098497019 12:71148087-71148109 TTATTATCTCAAATGTAGATTGG - Intronic
1099083826 12:78220146-78220168 ATTGTATTTCAAATTTCTTTGGG - Intergenic
1099281451 12:80653618-80653640 ATGCTTTTTCAAATGTATATTGG + Intronic
1099468341 12:83015341-83015363 AAAGCAATTCAAAGGTATATAGG - Intronic
1099518303 12:83626789-83626811 ATAGTAATTTTAATGTATATAGG + Intergenic
1099557033 12:84122478-84122500 ATAATATTTATAATGTATTTTGG - Intergenic
1100176639 12:92038289-92038311 ATATTATTTCATATGGATGTGGG + Intronic
1100337454 12:93644867-93644889 ACAGTGTTTCAAATATGTATTGG + Intergenic
1100873075 12:98932580-98932602 ATAGTATTTCATCTGTCTTTGGG + Intronic
1101352413 12:103944081-103944103 ATTGTATTTGATATGTAAATGGG + Intronic
1103030486 12:117608193-117608215 ATAGTATCTCAAGTGTCTAATGG + Intronic
1104219260 12:126766473-126766495 ATGGTATGTTAAATGTTTATAGG + Intergenic
1107382584 13:39873264-39873286 ATATGATGTCAAATGTGTATTGG - Intergenic
1108109510 13:47053546-47053568 ATAATATTTTACATGTTTATTGG - Intergenic
1108428344 13:50328108-50328130 ATAGTAAATGAAATATATATTGG - Intronic
1109226021 13:59696923-59696945 ATTGTATTTCAAATGAATTAGGG + Intronic
1109413133 13:62000014-62000036 ATAATACTTCAAATGTATTACGG + Intergenic
1110221923 13:73082984-73083006 ATAGTCATTCAAATGTCTTTGGG - Intergenic
1111789226 13:92832151-92832173 ATAGAATCTCAAAAGGATATAGG + Intronic
1111859467 13:93683556-93683578 ATAGAATTTAAAATGTATACAGG - Intronic
1112493955 13:99890984-99891006 ATAATATTTCAAAAATATATAGG + Intronic
1112679022 13:101740725-101740747 ATATCATTTCAAATATCTATAGG + Intronic
1112897854 13:104323281-104323303 CTCCTATTTCAAATGTACATGGG + Intergenic
1113259084 13:108541176-108541198 ATATTTTTTCAAATCAATATGGG + Intergenic
1114809850 14:25885434-25885456 ATAATATTTAATATCTATATAGG + Intergenic
1114933142 14:27500849-27500871 AAAATATTTATAATGTATATTGG + Intergenic
1116171050 14:41402940-41402962 ATATGGTTTCAATTGTATATAGG + Intergenic
1116367422 14:44084702-44084724 ATAGTTTTTCCAATGAATTTTGG - Intergenic
1117279697 14:54226828-54226850 ATTTTATTTTAAATGTATATTGG - Intergenic
1117650004 14:57893929-57893951 ATAGAAATTCAAAAGTATTTTGG + Intronic
1118135478 14:63021441-63021463 AAAGTATTTCAAGTGAATAGTGG - Intronic
1118170513 14:63384449-63384471 ATAGGATTTCAAAAGAACATTGG - Exonic
1118193668 14:63604451-63604473 GAAGTATTTCAAATGTACAAAGG + Intronic
1118665113 14:68060508-68060530 ATAGTATTTTAATTATTTATAGG + Intronic
1119813950 14:77548529-77548551 TTAGAATTTCAAATGTCTAGTGG + Intronic
1120061941 14:79993748-79993770 AAATTATTGCTAATGTATATGGG - Intergenic
1120282132 14:82453082-82453104 ATAGTATTTCAAATGCTCAATGG + Intergenic
1120406207 14:84096466-84096488 ATTATAATTCAAATGTAAATCGG + Intergenic
1120641823 14:87022893-87022915 ATACTCTTTCAAAAATATATTGG + Intergenic
1120861938 14:89262412-89262434 ATAGTATTTCCTATGTGTCTGGG - Intronic
1121855657 14:97267426-97267448 ATAGTTTTTAAAAGTTATATTGG - Intergenic
1121938299 14:98042021-98042043 ATAGTATCTCTAATGCATAGTGG - Intergenic
1121992220 14:98569490-98569512 AAAGTAATTCAAAATTATATTGG - Intergenic
1124039130 15:26083981-26084003 TAAGTATTTCAAACGTTTATGGG + Intergenic
1124984711 15:34595731-34595753 ATAGTATTTATAATGTATCAAGG + Intergenic
1125322587 15:38504216-38504238 ACAGTATTTATAAAGTATATAGG - Intronic
1125967397 15:43885474-43885496 GTAGGGTTTTAAATGTATATTGG - Intronic
1127065078 15:55228826-55228848 GTGATATTTCAAAAGTATATAGG + Intronic
1127416952 15:58767601-58767623 ATAGTACCTCAAATGTAAAAAGG - Intergenic
1127628407 15:60802677-60802699 ATATTATTTCAAAAGTAAAGAGG - Intronic
1128532984 15:68467659-68467681 ATAGTATTTCAAATTGAGATGGG + Intergenic
1128583794 15:68829494-68829516 ATTGTATTTCCATTGTATCTTGG + Intronic
1129141524 15:73602498-73602520 TGAGTATTTCAAATGTCTAAAGG + Intronic
1130372313 15:83295421-83295443 TTAGAATTTAAAATGTTTATAGG - Intergenic
1130640736 15:85672326-85672348 AAACTATTTTAATTGTATATAGG - Intronic
1131016935 15:89065629-89065651 CTTGTATTTCAAATGAATATAGG + Intergenic
1131238977 15:90721961-90721983 ATATTTTTACAAATGTATCTTGG - Intronic
1131288364 15:91081912-91081934 ATAGTTTTTTATATGTATGTAGG + Intergenic
1131603502 15:93875646-93875668 ATAATATTTTACATGTTTATGGG + Intergenic
1134819743 16:17237306-17237328 ATAGTTTCTCTAATGTATTTTGG - Intronic
1137998350 16:53245368-53245390 ATAGTTCTTCAACTGTATTTTGG - Exonic
1138038657 16:53635856-53635878 ATATTTTTTAAAATATATATGGG - Intronic
1138751222 16:59423808-59423830 ACAGCTTTTCATATGTATATTGG + Intergenic
1139000461 16:62504314-62504336 ATAGGACATCAAATGTATAGGGG - Intergenic
1140609390 16:76580262-76580284 ATAGTATGTGAAAACTATATAGG + Intronic
1141336586 16:83161424-83161446 ATTGTATTTTAAATGAGTATAGG + Intronic
1141843106 16:86587289-86587311 TTGGTATTTCCAATGTATTTTGG + Intergenic
1143257230 17:5569274-5569296 ATATTAATCCAAATGTAAATGGG + Intronic
1143617561 17:8062761-8062783 GTAGAATTTTAAATGTCTATTGG - Intergenic
1144440895 17:15280583-15280605 ACAGTATAAAAAATGTATATTGG - Intergenic
1145400994 17:22532580-22532602 ATAGTTTTTTAAATTTATCTAGG + Intergenic
1146749695 17:35367457-35367479 TTAGGATTTCAAATTTATATGGG - Intronic
1148898527 17:50856093-50856115 ATAGTAGTTAAAATGTAGCTTGG - Intergenic
1149149804 17:53547602-53547624 ATAATATTACAAAAGTATACTGG + Intergenic
1150874551 17:68954604-68954626 ATGTTATTTAAAATGTACATTGG - Intronic
1151368838 17:73634481-73634503 ATAAAATCTCAAATGTATGTGGG - Intronic
1152289121 17:79428885-79428907 ATAGTATTTGCACAGTATATTGG + Intronic
1153016562 18:587572-587594 ATAGTATTTTACATATTTATGGG + Intergenic
1153096779 18:1415915-1415937 ATAGTATTGCATATGTAGACTGG + Intergenic
1153210928 18:2763254-2763276 ATTGGTTTTCAAATGTATACAGG + Intronic
1153385795 18:4493994-4494016 ATTGTATTACAAATGTATGAAGG - Intergenic
1153967719 18:10196716-10196738 TTTGTACCTCAAATGTATATAGG + Intergenic
1153978859 18:10292369-10292391 AGAGTTTTTCAAATGTTTTTGGG + Intergenic
1154258484 18:12807452-12807474 TTAGGATTTCAAAGGCATATCGG + Intronic
1154503982 18:15015980-15016002 AAAATATTTATAATGTATATTGG + Intergenic
1155060141 18:22221165-22221187 ATAATATTTTGTATGTATATAGG + Intergenic
1155068544 18:22291162-22291184 ATAGTGTTGGAAATGTATATAGG - Intergenic
1155751509 18:29428637-29428659 AAAGAATTTGAAGTGTATATAGG + Intergenic
1155768268 18:29665214-29665236 ATAGTAATTCACACTTATATAGG - Intergenic
1156748189 18:40418140-40418162 ATATTATTTTATATGTATACAGG + Intergenic
1157748156 18:50155089-50155111 CTTGTTTTTCAAATTTATATGGG + Intronic
1159149838 18:64506342-64506364 AGAATTTTTCATATGTATATTGG + Intergenic
1159415454 18:68141797-68141819 ATGATATTTCAAATATGTATTGG - Intergenic
1159426892 18:68300569-68300591 ATTATTTTTAAAATGTATATAGG - Intergenic
1159993772 18:74941569-74941591 ATAGCATTTCAAGTATAAATAGG + Intronic
1164196586 19:22970992-22971014 ATATTATTCCAAATGTACAGAGG + Intergenic
1164460368 19:28442508-28442530 ATAGTATTTCAAATGAAGAAAGG + Intergenic
1164798949 19:31060004-31060026 ATAATATTTTACATGTTTATGGG - Intergenic
1165597467 19:37022162-37022184 ATTATATATCAAATGTATAGGGG + Intronic
925765525 2:7231317-7231339 ATAATATTTTAAATGTGTAAGGG - Intergenic
926768343 2:16345114-16345136 ATAGTATTTTAAATATTTATGGG - Intergenic
926865997 2:17358993-17359015 ATAGCATTTTTAATGTAAATGGG + Intergenic
926957640 2:18319082-18319104 TTAGTATTTCAAGTGGATGTGGG + Intronic
927287895 2:21375950-21375972 ATAGAATTTAACATGTAAATAGG + Intergenic
927840605 2:26440254-26440276 AGAGTATTTAAAATGTCTTTTGG - Intronic
928504613 2:31937744-31937766 CAAGTATTTTAAATGTATAAGGG + Intronic
930135184 2:47896023-47896045 ATAGTTTTTAAAATATAAATGGG - Intronic
931594008 2:63920818-63920840 ATAGTAGTTCAAATGAATTTAGG + Intronic
933289545 2:80422626-80422648 ATAGTTTTTTAAAAGTATTTTGG - Intronic
933340756 2:81023227-81023249 ATATTATTTCAATTGAATTTGGG + Intergenic
935231120 2:101097166-101097188 AAAATATTTCAAATGTTTAAAGG + Intronic
935336210 2:102019580-102019602 ATAGCCTTTGAGATGTATATTGG + Intronic
935437938 2:103056690-103056712 ACTGTCTTTCAAATTTATATAGG + Intergenic
935653480 2:105401347-105401369 ATAGTATTTCGTATATATATAGG - Intronic
936466070 2:112751818-112751840 ATAGTATTTAAATTTTATCTTGG - Intronic
938154919 2:128927333-128927355 ATTGTATTATACATGTATATTGG + Intergenic
938503166 2:131846165-131846187 AAAATATTTATAATGTATATTGG + Intergenic
939032478 2:137093117-137093139 ATAATATTTCAAATATTAATTGG - Intronic
939510087 2:143094389-143094411 ATAGTGTTTTAAATTTATTTGGG + Intronic
939772909 2:146345544-146345566 ATAATATTTCATATGAACATTGG + Intergenic
940204473 2:151187805-151187827 ATAATATTTCACATGTATTGAGG + Intergenic
940531193 2:154878696-154878718 ATACTCTTTTACATGTATATTGG - Intergenic
941386861 2:164863686-164863708 ATAAGATCTCAAATGCATATCGG - Intergenic
941547444 2:166869854-166869876 ATGGTATTTCAAATTATTATGGG - Intergenic
942589521 2:177527125-177527147 ATTTTTTTTTAAATGTATATGGG + Intronic
942799241 2:179857745-179857767 ATAATATTTGAAATGTATCATGG + Intronic
943227581 2:185198928-185198950 ATAATATTTTAAATTTGTATTGG - Intergenic
943444129 2:187962431-187962453 CTAGTATTTGATATGCATATAGG + Intergenic
943534257 2:189127401-189127423 ATAGCCTTTCAGATGTATTTTGG + Intronic
943839340 2:192558939-192558961 ACAATATTTCATATGTTTATAGG + Intergenic
944815963 2:203375425-203375447 AAAGTATTTCAAATTTATTCTGG - Intronic
945257851 2:207817189-207817211 AAATTATCTCAAATGTATAAAGG - Intergenic
946777160 2:223155356-223155378 ATATTATTTTAAAAGTGTATTGG + Intronic
947098905 2:226597589-226597611 ATAGTAGTTATTATGTATATGGG - Intergenic
948507810 2:238441806-238441828 ATAGTTTTGCAGATGTATTTTGG + Intronic
948971483 2:241431052-241431074 ATATTGTTTCAAATATTTATAGG - Intronic
1169824272 20:9749311-9749333 ATATTATTTTAAATGAATACTGG - Intronic
1170003406 20:11639995-11640017 GTAATATTTTAAATATATATGGG - Intergenic
1170232126 20:14060754-14060776 ACAGTATTTCAGATGTGCATAGG + Intronic
1170234821 20:14090732-14090754 AAAGTATGTCAAAGGGATATCGG - Intronic
1171254450 20:23678690-23678712 ATAGTATTTCTGATTTATTTTGG + Intergenic
1172818091 20:37705899-37705921 TTAGTATTTCAGCTGAATATTGG + Intronic
1174880449 20:54273701-54273723 ATAGTATTTTATATTTATAGTGG - Intergenic
1176678403 21:9802909-9802931 ATATTATTTCATGTGTACATGGG - Intergenic
1177045041 21:16158794-16158816 AGAGGATTTCAGATGTTTATGGG - Intergenic
1177115474 21:17080802-17080824 ATTGTATTTAAAAAATATATTGG - Intergenic
1177634652 21:23771972-23771994 AGAATATTTCTAATGTATGTGGG + Intergenic
1178809626 21:35869511-35869533 TTTATATTTCAAATGTTTATGGG + Intronic
1178860137 21:36282083-36282105 ATAGAACTTCAGAAGTATATTGG + Intronic
1179253016 21:39689311-39689333 ATAATATTTTACATGTTTATGGG + Intergenic
1183645116 22:39121294-39121316 ATAGAATTTCAAAGGAACATAGG - Intronic
1183800670 22:40161015-40161037 ATAATATCTAAAATGTATAAAGG - Intronic
1184303248 22:43576327-43576349 AAAATATTTCCAATTTATATAGG + Exonic
951232864 3:20199997-20200019 TTATTATTTCTAATGTAAATGGG + Intergenic
951441509 3:22728724-22728746 ATAGCATTTGAAATGAAAATGGG - Intergenic
951444248 3:22759014-22759036 ATTTTATTTCAGATGAATATGGG + Intergenic
951928311 3:27934985-27935007 ATGGTATTACCAATGTATATGGG - Intergenic
952021490 3:29026765-29026787 CTAGTATCTAAAATGTATAAAGG + Intergenic
952163380 3:30719008-30719030 ATAGTGTTTCCAATCTCTATTGG - Intergenic
952209167 3:31212015-31212037 ATATGAATGCAAATGTATATAGG - Intergenic
952346745 3:32495069-32495091 ATAGTAATTCAAATCTATACTGG + Intronic
952588841 3:34926714-34926736 ATAGTATATGAAATCTGTATAGG + Intergenic
953832857 3:46316769-46316791 ATAATATTTCAAATCCATATGGG - Intergenic
954054508 3:48010572-48010594 ATACGATCTCAGATGTATATGGG + Intronic
955017020 3:55080639-55080661 ATAGTATTTCCAATATCCATAGG - Intergenic
955566637 3:60254405-60254427 ATAGTATCTCTAATTTATATTGG - Intronic
955667188 3:61363114-61363136 AAAGTTTTTTAAATGTATTTTGG - Intergenic
955733608 3:62013712-62013734 ATAGTAGTTCAGTTTTATATTGG + Intronic
956035780 3:65089780-65089802 ATTGCTTTTCAAATGTATTTAGG - Intergenic
956179425 3:66503332-66503354 ATGTTTTTTCAAATGTGTATGGG + Intergenic
957010602 3:75001377-75001399 ATAGTATTTCAGATTCATAGTGG + Intergenic
957373762 3:79330523-79330545 ATTGTATTACAAATTTTTATTGG + Intronic
957413563 3:79871678-79871700 AAAGTTTTTCAAAGGTTTATAGG + Intergenic
957491118 3:80928785-80928807 AAAGCATTTCCTATGTATATGGG + Intergenic
958523965 3:95228329-95228351 ATAGTGTTTCTAATATATTTAGG + Intergenic
959122374 3:102247843-102247865 ATAGAATTTCAAAGGTTTTTTGG + Intronic
959267038 3:104155861-104155883 ATAAAATTTCAAATGTAAATTGG + Intergenic
960072615 3:113448268-113448290 AAAGTCTTTCAAGTGTATCTTGG - Intronic
962554690 3:136535820-136535842 ATAGTAGTTCACATTTTTATGGG - Intronic
962767497 3:138579258-138579280 ATAGTGTTTCAAGTTTATTTAGG - Intronic
965648686 3:170910229-170910251 ATAGTATTTAGTATTTATATAGG + Intergenic
966504218 3:180680538-180680560 TAAATATTTTAAATGTATATGGG + Intronic
966504764 3:180687246-180687268 AAAGTACTTTAAATGTATACTGG - Intronic
966628712 3:182048307-182048329 ACATTTTTTCAAATGTTTATTGG + Intergenic
966800473 3:183759026-183759048 ATAATTTTTCAAATGGAGATGGG + Intronic
966868211 3:184273479-184273501 ATAGTACTTGTAAAGTATATGGG - Intronic
969742072 4:9036025-9036047 GTAGAATTTCAAATGTCTAGTGG + Intergenic
969753123 4:9128263-9128285 ATAGAACTTCAAATGTCTAGTGG - Intergenic
969801446 4:9568904-9568926 ATAGAACTTCAAATGTCTAGTGG + Intergenic
970145612 4:13032414-13032436 CTAATATTTCTAATGTCTATTGG + Intergenic
970747886 4:19321109-19321131 AATGTATTTAAAATATATATTGG - Intergenic
971125812 4:23752721-23752743 ATAGTGTTTCAGATATATTTTGG - Intergenic
971396200 4:26229711-26229733 ATAATAGTTCCAATGTTTATGGG + Intronic
971613988 4:28764082-28764104 ATAGTATATAACATTTATATTGG - Intergenic
971749481 4:30628622-30628644 ATAGTATTTTATATATATAAAGG - Intergenic
972753434 4:42017190-42017212 ACATTTTTTCAAATGTTTATTGG + Intronic
973275915 4:48308356-48308378 AGAGAATTTCTAATATATATAGG + Intergenic
973912572 4:55596506-55596528 ATAATATTATAAATGTACATTGG - Intronic
973961515 4:56115063-56115085 ATAGTAATTCCAATGGGTATAGG + Intergenic
974120942 4:57638555-57638577 AAATTATTTCAAAGGAATATGGG - Intergenic
974362180 4:60895573-60895595 ATAGTTTTTCAATGGTATTTTGG - Intergenic
974886347 4:67822615-67822637 ATAATATTTCAAAAGGAAATAGG - Intronic
976536789 4:86226871-86226893 ATATCATTTCAAATGATTATAGG + Intronic
976550561 4:86390275-86390297 ATATTATTTAAAAAGTCTATTGG + Intronic
977661627 4:99594486-99594508 ATATTATTTCAACAGTATACAGG - Intronic
977856142 4:101896587-101896609 ATATTGTTAAAAATGTATATTGG - Intronic
978079938 4:104579755-104579777 ATCGTATTACAAAAGTTTATTGG - Intergenic
978663883 4:111159609-111159631 ATATTATTTCACCTGCATATAGG - Intergenic
979193126 4:117887587-117887609 ATAGTATTTCAGATACATATGGG + Intergenic
979411814 4:120388542-120388564 ATTGTATTTCAGATGTCTGTAGG - Intergenic
979706853 4:123730562-123730584 ATAGTATTTAATCTGTAGATTGG + Intergenic
980003761 4:127517825-127517847 TTAATATTTTAAATGTGTATGGG - Intergenic
980304695 4:131043485-131043507 AGAGTATTTCAAATTTAAATAGG - Intergenic
980464864 4:133160770-133160792 ATATTAGTTCTAATGTATATTGG + Intronic
980518050 4:133890583-133890605 ATATTATTTAAAATGTACAGAGG - Intergenic
980789331 4:137599184-137599206 ATAGAATCTCATATTTATATAGG - Intergenic
980835387 4:138185688-138185710 TTAGTATTAGAAATGTTTATAGG - Intronic
980924420 4:139120411-139120433 TTAGTATTTCAGTTGGATATAGG - Intronic
981880460 4:149605069-149605091 ACAGTATTACTAATGTGTATGGG + Intergenic
981895107 4:149789262-149789284 ATAATATTTTAAATATTTATGGG - Intergenic
982824790 4:159989177-159989199 ATATTATTGAAAATATATATAGG + Intergenic
983146385 4:164220308-164220330 ATAGGAATTCATATATATATAGG + Intronic
983210655 4:164954509-164954531 ATATAATTTTAGATGTATATTGG - Exonic
983341895 4:166471344-166471366 ATAATATTTCAACTGAATTTAGG + Intergenic
983415037 4:167441430-167441452 ATACAATTTCAATTGTTTATAGG + Intergenic
983610712 4:169642064-169642086 ATAAATTTTAAAATGTATATTGG - Intronic
983614858 4:169691745-169691767 ATAATATTTTAAATATATTTTGG - Intronic
983732915 4:171019843-171019865 ATAGTATTTCATATATATTAAGG + Intergenic
985208900 4:187571076-187571098 ATAATATTTAAAATATAGATTGG + Intergenic
985214351 4:187634927-187634949 ATAGTTTTTAAAATTTTTATAGG + Intergenic
985270918 4:188194328-188194350 ACAGTATTTCCAATTTATAATGG - Intergenic
985397151 4:189556060-189556082 ATATTATTTCATGTGTACATGGG + Intergenic
985461279 4:190109112-190109134 GTAGAATTTCAAATGTCTAGTGG + Intergenic
986086061 5:4449533-4449555 ATAGAATATCAAATGTATTCAGG + Intergenic
987250160 5:16092323-16092345 GAAATATTTCAAATGTACATTGG - Intronic
987458234 5:18173509-18173531 ATATTACTTCAAATTTAAATTGG + Intergenic
987825157 5:23021418-23021440 AGAGTATTGCAAAGGTACATAGG + Intergenic
987911619 5:24154609-24154631 ATATTCTTTCAAATTTATTTAGG - Intronic
989304304 5:39934531-39934553 ATAATATTTTAAATGTCTATTGG + Intergenic
989461314 5:41702272-41702294 ATGGAATTTTAAATGCATATAGG - Intergenic
990525462 5:56622109-56622131 ATAGTATTTCAGATTTAAACTGG + Intergenic
990801029 5:59603375-59603397 ATAGTTTTTCATATGTCTGTTGG - Intronic
991132507 5:63139484-63139506 ATAGATTTTAAAAGGTATATTGG - Intergenic
992044576 5:72872862-72872884 ATAGTATTAAAACTGGATATGGG + Intronic
992939148 5:81745660-81745682 ATAGGATTTCAAAATTATTTTGG - Intronic
993078196 5:83262741-83262763 ATAGTATTTCAAGTGAATACTGG + Intronic
993521137 5:88902731-88902753 ATAGTATTAGTAATTTATATTGG + Intronic
993560526 5:89401626-89401648 ATAGGCTTTCAAATTTCTATGGG - Intergenic
993629174 5:90263444-90263466 AAAGTATTGCAAATGAATAAGGG + Intergenic
994310236 5:98260596-98260618 ATAATATTACAAATATACATTGG - Intergenic
994534914 5:101017902-101017924 AGTGTAGTTCAAATGTTTATTGG + Intergenic
994704226 5:103181146-103181168 AAAGTATTAAAAATGTATACAGG - Intronic
994888949 5:105604341-105604363 AAACTATTTAAAATGTAAATAGG + Intergenic
995953423 5:117744704-117744726 ATGGTATTTTAAATTTATTTTGG - Intergenic
995980532 5:118097505-118097527 AGAATATTACAAATGTATAGGGG - Intergenic
996184549 5:120459879-120459901 ATAGGATTTCAAATTAATTTTGG + Intergenic
996300667 5:121980237-121980259 ATAGTATTACAATTTTCTATAGG - Intronic
996507258 5:124281567-124281589 ATAATATGTCAAATGTACAATGG + Intergenic
996852430 5:127967395-127967417 AAAGTATTTCAAAGGCATTTTGG - Intergenic
996979823 5:129477539-129477561 AAAGCATTTCAAATGAAAATAGG - Intronic
997049383 5:130361650-130361672 ATATCATTTCATATGAATATAGG + Intergenic
998085137 5:139315012-139315034 ATAGTATTTGATATGTAGAGTGG + Intronic
998190773 5:140022514-140022536 ATAGTAGATCAAATGTTTATTGG - Intronic
998628119 5:143868640-143868662 ATGGGATTTTAAATGTATTTGGG - Intergenic
998658649 5:144210347-144210369 ATAGCATTTCACCTGTATTTTGG - Intronic
998713590 5:144853702-144853724 ATAGTATTCAAAATGTTTTTAGG + Intergenic
999376568 5:151090872-151090894 ATAGTTTTTCAGATGTCTACTGG + Intronic
999499264 5:152130464-152130486 AAAGGATTTCAACTGGATATGGG - Intergenic
999820091 5:155218612-155218634 ACAGTATTTCAAATGACTGTAGG + Intergenic
999945821 5:156594197-156594219 ATAAAATTTTAAATGTATATTGG + Intronic
1000541306 5:162543476-162543498 ATTGTATTACAATTGTATAATGG + Intergenic
1000650272 5:163809299-163809321 AAAATAATTCAAATTTATATGGG - Intergenic
1000809674 5:165845517-165845539 ATAGTAGTTACAATGTAAATAGG + Intergenic
1002120953 5:177004421-177004443 ATAGTAGTTGAACTGTATACAGG - Intronic
1003652643 6:7975545-7975567 ATAGTTTATCAAATGTGAATCGG + Intronic
1004363491 6:14992081-14992103 AGAAGATTTCAAATGTACATGGG - Intergenic
1004774453 6:18827191-18827213 GTAGTTATTCAAATGTAGATGGG + Intergenic
1004901149 6:20195353-20195375 AGAGTATGTCAAATGGACATAGG - Intronic
1004962463 6:20805959-20805981 ATATGATTTCAAATGTTTTTTGG + Intronic
1005643797 6:27822279-27822301 GTAGTATTTCTTTTGTATATGGG + Intergenic
1006974962 6:38091414-38091436 ATACTATTTAAAAAGCATATCGG + Intronic
1006991627 6:38219755-38219777 AAAGTATAACAAATGTTTATTGG - Intronic
1007010382 6:38411389-38411411 ATACAATTTCAAATGTAGTTTGG - Intronic
1008110551 6:47488445-47488467 ATAATATTTTGAATGTATGTTGG + Intronic
1008120069 6:47603862-47603884 ATAGTATTTTCAATATAAATAGG + Intronic
1008235175 6:49037697-49037719 CTAGTATTTCAAAATTAGATGGG + Intergenic
1008319739 6:50095175-50095197 AAAGTATTTTAATTGTATAAGGG - Intergenic
1008726763 6:54430974-54430996 ATAATACTTCAAATGTTTAAGGG - Intergenic
1008840664 6:55899574-55899596 ATAGTATTTTTAAAGTATGTTGG - Intergenic
1008908697 6:56709307-56709329 ACAATATTTCAAATTTATTTTGG + Intronic
1008920183 6:56835418-56835440 ATAGTTTCTCATATTTATATCGG - Intronic
1008921564 6:56848726-56848748 ATTGTATTTTAAATAAATATTGG - Intronic
1009422758 6:63482123-63482145 ATAATATGTCAAGTGTAAATAGG - Intergenic
1009632496 6:66216478-66216500 ATTGTATGTTAAATGTGTATGGG - Intergenic
1010107661 6:72188282-72188304 ATATGATTTCAGATGTGTATGGG - Intronic
1010859431 6:80888651-80888673 ATAATTACTCAAATGTATATGGG + Intergenic
1011715184 6:90097639-90097661 ATAATTTTTAAAAAGTATATCGG - Intronic
1012048618 6:94310505-94310527 ATATTGATTCAAATGAATATTGG - Intergenic
1012077406 6:94708035-94708057 ATAGTTTCTCAGATATATATTGG - Intergenic
1012734140 6:102917630-102917652 ATTGTATTTTGAATGTATAATGG - Intergenic
1012768806 6:103402845-103402867 ATAATATTTCAAATTTAAAATGG + Intergenic
1013324433 6:109030721-109030743 ATAAAATGTAAAATGTATATAGG + Intronic
1013375648 6:109511315-109511337 ATAATTTTTAAAATGTATAATGG + Intronic
1013680423 6:112519497-112519519 TAAGTATTTCTAATGTACATAGG + Intergenic
1013911877 6:115285249-115285271 ATATTATTTAAAATGAATATGGG - Intergenic
1014097876 6:117480184-117480206 TTAGTATGTGAAATGTTTATAGG + Intronic
1014181922 6:118394130-118394152 ATATTATTTCAAATCTTTTTTGG - Intergenic
1014206630 6:118663142-118663164 ATACTATTAGAAGTGTATATCGG - Intronic
1014775612 6:125506129-125506151 TAAGTATTTCAAAAGTATCTAGG - Intergenic
1015286769 6:131494444-131494466 TTAGTATTTCAATTATCTATAGG + Intergenic
1016070215 6:139729879-139729901 ATAGCACTTCATATTTATATAGG - Intergenic
1016192827 6:141291809-141291831 ATGCTATTTCAAATATATAAAGG - Intergenic
1017016014 6:150100047-150100069 ATTCTATTTCGAATATATATGGG - Intergenic
1017957105 6:159187735-159187757 ATATTTTTTCAAATGGATGTTGG - Intronic
1018103809 6:160464794-160464816 ATAGAATAAGAAATGTATATTGG + Intergenic
1018112097 6:160546008-160546030 ATAGAATAAGAAATGTATATTGG + Intronic
1018293636 6:162319639-162319661 ACATTATTTCAAATGAAAATAGG + Intronic
1018519476 6:164631313-164631335 TTACTTTTTCAAATATATATTGG + Intergenic
1020554514 7:9654174-9654196 ATAAATTTTCAAATGTATACAGG - Intergenic
1021901783 7:25292672-25292694 ATAGTTTTTCATATGCATGTGGG - Intergenic
1022252413 7:28621364-28621386 ATAGTGTTTAAAATCTATTTTGG - Intronic
1024429420 7:49269134-49269156 ATATTTTTTCAAAAGGATATTGG - Intergenic
1024705343 7:51952332-51952354 ATAGTTTTTCAAATAAACATGGG + Intergenic
1024836744 7:53529397-53529419 ATAATATTTAAAAAGTATTTTGG + Intergenic
1025008467 7:55375388-55375410 ATGGTATTTAAAATGCATTTAGG - Intronic
1025578387 7:62677795-62677817 ATAGTCTTCCAAATATATCTTGG - Intergenic
1025578771 7:62683296-62683318 ATAGTCTTCCAAATGTCTGTTGG - Intergenic
1026094817 7:67337270-67337292 ATAGTATTAGTAATTTATATTGG - Intergenic
1027816973 7:82987382-82987404 ATAGTATGTCAGATATAAATGGG + Intronic
1027899830 7:84098028-84098050 CTATTATTTCTAATGTAAATGGG - Intronic
1028208812 7:88048571-88048593 ATATGTTTTGAAATGTATATTGG + Intronic
1029811331 7:103052237-103052259 ATAGTATACTAAATGAATATTGG - Intronic
1030242662 7:107345818-107345840 AGAGTATGTCAAATTTATATTGG + Intronic
1031255391 7:119440808-119440830 AAAATATTTCAAATGTTTAAAGG - Intergenic
1032562415 7:132905998-132906020 ATAGTATTGTAAATGTGTAAAGG - Intronic
1032715112 7:134501938-134501960 ATACTTTTTCATATGTTTATTGG - Intergenic
1032767474 7:135011638-135011660 ATATTATCTCATATGTTTATTGG - Intronic
1033204630 7:139407710-139407732 AAAATATTTCAAATTAATATTGG - Intronic
1033264293 7:139871487-139871509 ATGGTATTTCAACAGTTTATAGG - Intronic
1033486416 7:141793339-141793361 ATAGTATTTAACATTTGTATTGG + Intergenic
1033805343 7:144947679-144947701 ATAATTTTTAAAATATATATGGG - Intergenic
1034141385 7:148821522-148821544 ACAGATTTTGAAATGTATATAGG + Intronic
1035134599 7:156689052-156689074 ATACTTTTACAAATGTGTATAGG - Intronic
1037346870 8:17910162-17910184 GCAGAATTTCAAATGTCTATTGG + Exonic
1037366196 8:18124620-18124642 ACAGTATTTCAGATGTAAAATGG - Intergenic
1038279487 8:26150911-26150933 CTAGTATGTCAAATGGAAATTGG + Intergenic
1039295261 8:36144559-36144581 ATGGTATTTTAAATGTGTACTGG - Intergenic
1039313140 8:36341814-36341836 TTAGTATTTCAAATTAATAATGG - Intergenic
1040076558 8:43239257-43239279 ACAGTATATCATATGTATTTTGG - Intergenic
1040744451 8:50623931-50623953 ATCATATTTCAAAAGAATATGGG - Intronic
1040757200 8:50791113-50791135 AAAGTATTTAAAATGTGTTTGGG + Intronic
1041473815 8:58240523-58240545 AAAGTCTTACACATGTATATAGG + Intergenic
1041489649 8:58418773-58418795 ACAGTATTTTATATGTATAAAGG - Intronic
1041502620 8:58554779-58554801 AAAGTATTTCAAAGTTATTTGGG - Intronic
1041600847 8:59716002-59716024 ATATTGTTTCTAAAGTATATCGG + Intergenic
1042501130 8:69510461-69510483 AGATGATTTCAAATGTATAAAGG + Intronic
1042926626 8:73974085-73974107 AGAGTTTTTAAAATGTAAATAGG + Intronic
1043629874 8:82316983-82317005 ATAGCATTTTAAAACTATATAGG + Intergenic
1044230648 8:89773741-89773763 ATAGTATTTCAGAGGTAGAATGG + Intronic
1045456435 8:102384315-102384337 TTTGTGTTTAAAATGTATATGGG + Intronic
1046371277 8:113310222-113310244 ATAATATTTCATATGTATTAAGG + Intronic
1047099299 8:121658539-121658561 ATAATATTTTAAATTTATTTTGG + Intergenic
1049982360 9:916031-916053 AGAGTATTTAAAATGACTATAGG - Intronic
1050341452 9:4643632-4643654 ATAGTATTTCCATAGTATTTTGG - Intronic
1050611017 9:7353819-7353841 ATAGCATTTCAAGTTTCTATAGG + Intergenic
1051124493 9:13788874-13788896 ACAGAATTTCAAATACATATGGG - Intergenic
1051470455 9:17434397-17434419 ATAGTATATTAAAAGAATATGGG - Intronic
1052149517 9:25097289-25097311 ATACAATTTGAAATGTTTATAGG - Intergenic
1053389211 9:37721845-37721867 ATTGTATATGAAATGCATATTGG + Intronic
1054800530 9:69344031-69344053 ATAGTAGTACATATGTATTTGGG + Intronic
1055253774 9:74340752-74340774 CTAGTATTTGAATTGTGTATGGG - Intergenic
1055846218 9:80566315-80566337 ATAATATTTCTACTGTATATTGG + Intergenic
1058273904 9:103013320-103013342 ATAATATATTAAATATATATAGG - Intronic
1060333272 9:122695712-122695734 ATATTATTATAAATGTTTATTGG + Intergenic
1060669228 9:125453992-125454014 ATGGTTATTCAAATGAATATTGG - Intronic
1061342512 9:129993924-129993946 ATAGTATTTTAAAAGTACTTCGG - Intronic
1203663570 Un_KI270754v1:5448-5470 ATATTATTTCATGTGTACATGGG - Intergenic
1186065817 X:5763356-5763378 AAACTATTTCAAATAAATATGGG + Intergenic
1186609045 X:11120792-11120814 ATATTATGTGAAATGTATACAGG + Intronic
1188377477 X:29449591-29449613 AAAGTCTTTGAAATCTATATTGG + Intronic
1188412611 X:29892531-29892553 ATAGAATTTAGAATGTATCTGGG + Intronic
1188862823 X:35277026-35277048 AGATTATTTGAAATTTATATTGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1189946557 X:46186605-46186627 AAAGTCTTTAAAATGTTTATAGG + Intergenic
1189965907 X:46373002-46373024 ATGGTATTTCAAAGGAATGTTGG - Intergenic
1190412828 X:50153930-50153952 ATAGAATTGTAAATATATATTGG - Intergenic
1191599019 X:62982972-62982994 ACTGTGGTTCAAATGTATATAGG + Intergenic
1191961608 X:66709067-66709089 ATATTATTTAAAATGTTAATAGG + Intergenic
1192834426 X:74784076-74784098 ATCGTATTTCAATAGTATTTAGG + Intronic
1192948507 X:75991094-75991116 GAATTATTTCAAATGTATTTAGG + Intergenic
1192982257 X:76358140-76358162 ATAGTATATTAAATAGATATCGG - Intergenic
1193670521 X:84379223-84379245 ATAATATTTCAGATCTATATGGG - Intronic
1195884018 X:109621868-109621890 ATATTCTTTTAAATGTCTATGGG + Intergenic
1196292921 X:113965107-113965129 ATAGTATTTCAGTTAAATATTGG - Intergenic
1198615244 X:138451097-138451119 AGAATATTTTAAATGCATATTGG - Intergenic
1199206448 X:145154653-145154675 ACAGTGTTTCAAATAGATATTGG - Intergenic
1199268619 X:145856901-145856923 ATATTTATTTAAATGTATATTGG - Intergenic
1200435765 Y:3148155-3148177 AAATTTTTTTAAATGTATATGGG + Intergenic
1201369368 Y:13244511-13244533 ATAATATTTCCCATATATATGGG - Intergenic
1201777155 Y:17678582-17678604 ATAGGATCTCAAATGTCTCTTGG + Intergenic
1201824402 Y:18227410-18227432 ATAGGATCTCAAATGTCTCTTGG - Intergenic