ID: 1097293615

View in Genome Browser
Species Human (GRCh38)
Location 12:57941334-57941356
Sequence CGCTGCTGCCCTCCCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097293615_1097293623 14 Left 1097293615 12:57941334-57941356 CCCACACTGGGAGGGCAGCAGCG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 49
1097293615_1097293619 -5 Left 1097293615 12:57941334-57941356 CCCACACTGGGAGGGCAGCAGCG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1097293619 12:57941352-57941374 CAGCGAAATCCGCGGCAGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 52
1097293615_1097293618 -6 Left 1097293615 12:57941334-57941356 CCCACACTGGGAGGGCAGCAGCG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1097293618 12:57941351-57941373 GCAGCGAAATCCGCGGCAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 73
1097293615_1097293622 13 Left 1097293615 12:57941334-57941356 CCCACACTGGGAGGGCAGCAGCG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1097293622 12:57941370-57941392 CCGGGTTGTTACAGCCTTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097293615 Original CRISPR CGCTGCTGCCCTCCCAGTGT GGG (reversed) Intergenic
900345778 1:2209645-2209667 GCCTGCTGCCCTCCCCCTGTTGG - Intronic
900476501 1:2878737-2878759 CGCTGCTGCCCTTCCAGCCTCGG - Intergenic
902897025 1:19485830-19485852 CGCTGCTGCAGGCCCAGAGTCGG - Intergenic
903291917 1:22319380-22319402 CGCTGCTGCCCTCCAAGGCCAGG + Intergenic
903767014 1:25741520-25741542 CCCTCCTGCCGTCCCACTGTGGG + Intronic
904684819 1:32252276-32252298 CGCTTCAGCCCTGCCTGTGTAGG + Intronic
906489974 1:46260667-46260689 CGCTGCTGCTGTCCCAGGGATGG - Intronic
908686409 1:66725090-66725112 CACTGCTGACCTCCCAGTTTGGG - Intronic
912946583 1:114089783-114089805 CGCTGCTGCTCTAGCAGTCTGGG - Exonic
914675368 1:149904006-149904028 CCCTGCTCCCCTCCCTGTGAGGG + Exonic
914919485 1:151837976-151837998 CGCTGCTGCCCCCGCTGGGTGGG - Exonic
923650297 1:235867055-235867077 CGGCGCTGCCCTCCCAGAGGAGG - Intronic
1062863117 10:825704-825726 CGCTACTGCCCTTCCGGAGTTGG - Intronic
1067136818 10:43616394-43616416 AGCTTCTGCCCTCCCAGTCCAGG - Exonic
1067225345 10:44372780-44372802 CCCTGCTGCCCTCCCAGAAGAGG + Intronic
1067449207 10:46371036-46371058 AGCCGCTGCCCTCCCAGTCCAGG - Intronic
1067588163 10:47489729-47489751 AGCCGCTGCCCTCCCAGTCCAGG + Intronic
1067635287 10:47997820-47997842 AGCCGCTGCCCTCCCAGTCCAGG + Intergenic
1067698641 10:48553106-48553128 CTCTGCTCCCCTCCCACTGGGGG - Intronic
1067877838 10:50020452-50020474 CGATGCTGCCACCCCAGTGCCGG + Intergenic
1069262425 10:66415061-66415083 CCCTGCTGCCCTGCCAGTGGGGG - Intronic
1069699446 10:70410949-70410971 CCCTGCTGCCCTAGCAGTGTTGG + Intronic
1071609840 10:87022250-87022272 AGCCGCTGCCCTCCCAGTCCAGG - Intronic
1071816327 10:89235488-89235510 CAACGCTGCCTTCCCAGTGTGGG + Intronic
1072895158 10:99360168-99360190 CCCTGATTCCCTCCCAGTGGAGG + Intronic
1074488149 10:113910240-113910262 CGCCACTGCCCTCCCAGCCTGGG - Exonic
1074528570 10:114281254-114281276 AGCTGCTGCCAACCCAGAGTGGG + Intronic
1075107684 10:119552594-119552616 CTCTGCTGCTCTCCCAGGTTGGG - Intergenic
1076628927 10:131841243-131841265 CGTTGGTGCCCTCCGGGTGTAGG + Intergenic
1076738095 10:132467652-132467674 CGAGGCTGCCCTCCCAGGGGTGG + Intergenic
1076821764 10:132943197-132943219 CGCTGCTACCCTCTCCGTGGGGG - Intergenic
1076875864 10:133215226-133215248 CCCTGCTGCTGTCCCAGAGTGGG + Intronic
1077266599 11:1653794-1653816 CCCTGCTTCTCACCCAGTGTGGG + Intergenic
1078265933 11:9756423-9756445 AGCTGTTGCCCTCCCAGCCTGGG + Intergenic
1082724426 11:56718383-56718405 CTCTGCAGGGCTCCCAGTGTAGG - Intergenic
1085039989 11:73321324-73321346 CTCTGCTCTCCTCCCCGTGTGGG - Intronic
1085177376 11:74502502-74502524 TGATGCTGACCACCCAGTGTTGG + Intronic
1085798628 11:79566629-79566651 GGATGTTGCCCTCTCAGTGTGGG + Intergenic
1087180061 11:95133106-95133128 CTTGGCTGCCTTCCCAGTGTGGG + Intergenic
1092784670 12:12016513-12016535 GGCTGCTGCCCTCACAGTACAGG - Intergenic
1094121064 12:26974651-26974673 CCCTACTGCACTCACAGTGTAGG + Intronic
1096586294 12:52622461-52622483 CTCAGCTGCTCTCCCAGAGTTGG - Intergenic
1096649868 12:53057075-53057097 AACTGCAGCCCTCCCAGCGTCGG + Exonic
1096651402 12:53063639-53063661 CGCTGCTGTCCTCTCAATGCTGG + Intronic
1096673838 12:53215789-53215811 CACTGCTTCCCTCCCAGCGGTGG - Exonic
1096696228 12:53350413-53350435 CGCCACTGCACTCCCAGTCTGGG + Intergenic
1097293615 12:57941334-57941356 CGCTGCTGCCCTCCCAGTGTGGG - Intergenic
1097664958 12:62467512-62467534 CTCTCCTGTCCTCCCAGTTTAGG + Intronic
1099478113 12:83132858-83132880 CGCTGCTGTCTTCCCTGTTTGGG + Exonic
1101045376 12:100799891-100799913 CCCTGCTCCATTCCCAGTGTGGG + Intronic
1102476321 12:113191217-113191239 TGCTGCTGCCATCCCAGGGTGGG + Intronic
1105978533 13:25495160-25495182 TGCTGCTGCCCTTCCAGGGTGGG + Intronic
1108192581 13:47957447-47957469 AGCAGCTGCCCACCCAGTTTTGG + Intronic
1109370068 13:61412208-61412230 CACTGTGGCCCTCACAGTGTTGG - Exonic
1110223566 13:73096976-73096998 CCCTGCTTCTCTCCCAGCGTAGG - Intergenic
1112040355 13:95541036-95541058 AGCTGCTGCATTCTCAGTGTGGG - Intronic
1113811388 13:113144495-113144517 CGCTGATGCCCCTGCAGTGTGGG - Intronic
1115752688 14:36507131-36507153 CCCTCCTGCCTCCCCAGTGTAGG - Intronic
1116429663 14:44831197-44831219 TGCTAGTGCCCTCCCACTGTGGG + Intergenic
1119781328 14:77278355-77278377 CTCACATGCCCTCCCAGTGTGGG - Intronic
1123490511 15:20776075-20776097 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1123547012 15:21345162-21345184 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1123989724 15:25674390-25674412 CTCTGCTGTCTTCCCAGCGTAGG + Intergenic
1124063331 15:26316610-26316632 CTCTGTTGCCCTCCCAGCCTGGG + Intergenic
1124604593 15:31161029-31161051 CGCTCCTGCCCACCCAGGGAGGG - Exonic
1126412117 15:48383186-48383208 GGCTGCTGTCCTCCATGTGTTGG + Intergenic
1129317341 15:74753056-74753078 CTCCCCTCCCCTCCCAGTGTAGG + Intronic
1129373218 15:75110738-75110760 TCCCGCTGCCCTCCCTGTGTGGG - Intronic
1129693792 15:77729126-77729148 CCCAGCTTCCCTCCCAGTGCCGG - Intronic
1129968591 15:79758079-79758101 CGCTGCTGCTCTCAGAGTCTTGG - Intergenic
1130047461 15:80456770-80456792 AGCTGCTGGCCTCCCAGTAAGGG - Intronic
1132106058 15:99063626-99063648 AGCTGCTGCCCCTCCACTGTAGG + Intergenic
1132244819 15:100286245-100286267 CCCTGCTGCCCTACCACTGATGG + Intronic
1132266444 15:100476155-100476177 CCCTGCTGCCATCCCAGTACTGG - Exonic
1202955344 15_KI270727v1_random:72378-72400 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1132556256 16:574010-574032 TGCTGCTGCCCCCCCACCGTGGG - Intronic
1133225100 16:4337193-4337215 CGCTGCTGCCCTCGCCCTTTGGG + Exonic
1133775097 16:8889528-8889550 CGCTGCTGACCTCTCAGGGCTGG + Intergenic
1139347048 16:66310676-66310698 CGTTCCTGCCTCCCCAGTGTCGG - Intergenic
1142164584 16:88579358-88579380 ACCTGCTGCACTCCCAGTGGTGG - Intronic
1142799835 17:2337974-2337996 CGCAGCTCCCCGCCCAGTGACGG + Intronic
1144999984 17:19297718-19297740 TGCTCCTGCCCTCCTAGTTTAGG - Intronic
1146932988 17:36791303-36791325 CCCTGCTGCCCTCCCTGCTTTGG + Intergenic
1147249971 17:39147403-39147425 CTCTGCTGCCCCCTCGGTGTTGG + Intronic
1147993963 17:44351346-44351368 CTCTGCTTCCCTCACAGTGGGGG + Exonic
1148473899 17:47914512-47914534 CGATACTTCCCTCCCAGTTTTGG + Intronic
1151652776 17:75480454-75480476 CTCTGCTCCCCTCCAGGTGTGGG - Intronic
1152133486 17:78491045-78491067 TGCTGCAGCCCTCACGGTGTGGG - Intronic
1152554284 17:81045346-81045368 CGCTTCTGCCCTCCGCCTGTGGG - Intronic
1152761863 17:82112688-82112710 CCCTGCTTCCCTCCCTGTGCCGG + Intronic
1152781628 17:82229493-82229515 TGCTGCAGCCCTCCCTGTATGGG + Intronic
1153036658 18:769993-770015 CGCCACTGCACTCCCAGTCTGGG - Intronic
1155953742 18:31939827-31939849 CACTCCAGCCCTCCCAGCGTGGG + Intronic
1158685263 18:59608031-59608053 CGCCACTGCACTCCCAGTTTGGG + Intronic
1159788906 18:72751584-72751606 AGCTCCTGCCCTCCAAGTGAAGG - Intronic
1160532452 18:79573512-79573534 AGCTGATGCCCACCCAGCGTGGG + Intergenic
1160939959 19:1615586-1615608 CGCCGACGGCCTCCCAGTGTGGG + Intronic
1160993620 19:1871887-1871909 CCCTGCTGCCCACCCTGTGCAGG - Intergenic
1162197777 19:8998958-8998980 TGCTGCTGCCATCCCGTTGTAGG + Intergenic
1162497567 19:11031928-11031950 CGCTGCTGCCCTCACGCTGCAGG - Intronic
1162793699 19:13075939-13075961 GGCTGCGGCCATCCCACTGTGGG - Intronic
1163643925 19:18477597-18477619 TGAAGATGCCCTCCCAGTGTCGG - Intronic
1165225400 19:34351317-34351339 CGCTCCTGCACTGCCAGTGCAGG - Intronic
1166001788 19:39881815-39881837 CGCAGCTGGCTTCCCAGTGAGGG + Intronic
1166004569 19:39898066-39898088 CGCAGCTGGCTTCCCAGTGAGGG + Intronic
1167233230 19:48298058-48298080 CGACGCTGCCCTCCTAGTGCTGG - Exonic
1167889524 19:52528242-52528264 CCCTGCGTCCTTCCCAGTGTGGG - Intronic
925130953 2:1493701-1493723 CCCTGCTGCGCTTCCAGTCTCGG + Intronic
925931336 2:8710347-8710369 GGCTGCTGGCCTCCCATGGTGGG - Intergenic
926129200 2:10290341-10290363 CTCTGCTGCCCTCACAGCTTCGG - Intergenic
928226684 2:29455361-29455383 CCTTGCTGCTCTCCCAGGGTAGG - Intronic
929615881 2:43306887-43306909 AGCTGCTGTTCTCCCAATGTTGG + Intronic
932030381 2:68177666-68177688 CCATGTTGGCCTCCCAGTGTTGG - Intronic
935515119 2:104026829-104026851 CGGGGCTGCGCTGCCAGTGTGGG - Intergenic
935635933 2:105249878-105249900 AGATGCTGACCTCCCAGTGAGGG - Intergenic
938122251 2:128642153-128642175 CCCTGCTGCCTTCCCAGTTCTGG - Intergenic
938127532 2:128685252-128685274 CACTACAGCCCTCCCAGTGCTGG - Intergenic
942229546 2:173847443-173847465 AGCTGCTGCTCTCCCTGTGTTGG - Intergenic
942864077 2:180651096-180651118 ACCTGCTGCCCTCCAAGAGTTGG + Intergenic
948231841 2:236354802-236354824 GCCTGATGCCCTCCCTGTGTGGG + Intronic
948956151 2:241293454-241293476 CGCTACTGCACTCCCAGCCTGGG + Intronic
1172569045 20:35954587-35954609 GGCTGCTGCCCTCGCGGTGCGGG + Exonic
1173875943 20:46371609-46371631 AGCTGCTGCCCTCACAGAGCCGG + Exonic
1175200065 20:57270612-57270634 GCCTGCTGGCCTCCCAGTGCTGG + Intergenic
1175488093 20:59359793-59359815 CACTGGTGCCCTGCCAGTGCCGG - Intergenic
1176167234 20:63680648-63680670 CCCTGCTGCCCTCCAGGTGCTGG + Exonic
1176277018 20:64278333-64278355 TGCTGCTGCCCTCTGAGTCTGGG - Intronic
1178919393 21:36728723-36728745 CTCTGCTGTCCTCCCAGGGCTGG - Intronic
1179824444 21:43956270-43956292 CACTGCAGCCCCCCCAGGGTGGG - Intronic
1179829147 21:43985131-43985153 CGCCGCTGGCCTCCCAGCTTAGG + Exonic
1180036831 21:45254345-45254367 GGCTGCTGCGGTCCGAGTGTCGG + Intergenic
1180694478 22:17742997-17743019 CTCAGCCGCCCTCCCACTGTAGG - Intronic
1181755523 22:25021738-25021760 CGCTGGTGTCCTCCCAGAGAAGG - Intronic
1182711717 22:32327432-32327454 CTCTGCTTTCCTCCCAGTGAAGG - Intergenic
1183428604 22:37752492-37752514 CGCTCCTGCCCAGGCAGTGTGGG - Intronic
1183489005 22:38106912-38106934 CTCTGCGGCGCTCCCAGTCTTGG + Intronic
1183617463 22:38954353-38954375 CAGTGCTGTCCTCCCAGGGTGGG - Intronic
1184147913 22:42622394-42622416 CGCAGCTGACCTTCCAGTGGGGG - Intronic
1184399247 22:44264220-44264242 CTCTGCTTTCCTCCCAGTGAAGG - Intronic
1184801318 22:46762281-46762303 CGCAGCCGCCCTGCCACTGTTGG + Intergenic
1185223311 22:49639908-49639930 GCCAGCTGCCCTCACAGTGTGGG + Intronic
950032075 3:9860005-9860027 CGCTGCTGCCCCCACAGAGACGG - Intergenic
954384811 3:50238440-50238462 GGCTGCTGCCAGCCCAGTGTGGG - Intronic
961077039 3:123992043-123992065 CGCTGCTGCCCTCCCCGCCGAGG - Intronic
961307537 3:125969257-125969279 CGCTGCTGCCCTCCCCGCCGAGG + Exonic
961371413 3:126434080-126434102 GCCTGCTGACCTCCCAGGGTGGG - Intronic
964511647 3:157459164-157459186 CCGTGCTGCCCTGCCAGTGATGG - Intronic
964792245 3:160463268-160463290 TGCTGCTGCATTCCCAGAGTTGG + Intronic
965390378 3:168096063-168096085 CGCACCTTCCCTCCCAGTGCCGG + Intergenic
966097402 3:176220684-176220706 TGCTGCAGAGCTCCCAGTGTGGG - Intergenic
967080494 3:186045183-186045205 CACTGCCGCCCTTCTAGTGTTGG - Intergenic
967867726 3:194204123-194204145 CGCTGCTGCCCTCGCTGTCAGGG - Intergenic
968047336 3:195631625-195631647 CGCGGCTGCCTTCCGTGTGTGGG - Intergenic
968307277 3:197658299-197658321 CGCGGCTGCCTTCCGTGTGTGGG + Intergenic
968506640 4:973960-973982 CGCTGCGGGCCTCCCACAGTGGG + Intronic
968880727 4:3297786-3297808 CGCTGCTGTCCTCCATCTGTGGG + Intronic
969448627 4:7260047-7260069 CTCTCCTGCCCTCCCAGGCTTGG + Intronic
969560922 4:7947491-7947513 CGCCACTGCACTCCCAGTCTGGG + Intergenic
972175297 4:36397226-36397248 AGCTGCTTCCCTTCCAGTGGGGG + Intergenic
972614859 4:40688247-40688269 CACTGGTCCCCTCCCAATGTGGG + Intergenic
975712517 4:77174648-77174670 AGCTGCTGCCCTCCTGGTGGTGG + Intronic
982611379 4:157577986-157578008 CACTGCTGACTTCACAGTGTTGG + Intergenic
985744268 5:1637535-1637557 CGCGGCTGCCTTCCATGTGTGGG + Intergenic
985889590 5:2705339-2705361 AGCTGCTCCCCTCCTAGCGTGGG + Intergenic
985894601 5:2740808-2740830 CGCTGTCGCCTTCCCAGTGCTGG - Intergenic
985906971 5:2846274-2846296 AGCAGGTGCCCTCCCAATGTGGG - Intergenic
985998800 5:3613895-3613917 CCTGGCTGCTCTCCCAGTGTGGG - Intergenic
986133190 5:4949529-4949551 TGGTGCTGCCCTTCCATTGTTGG - Intergenic
988444900 5:31274776-31274798 CGCTACTGCACTCCCAGCCTGGG + Intronic
989164856 5:38423962-38423984 GGCTCCTGCCCTCACAGGGTGGG + Intronic
992228276 5:74640122-74640144 CGCCGCTGCCCTCCCACAGCAGG - Intronic
995595684 5:113745544-113745566 TGTTCCTGCCCTCCCAGTGGGGG + Intergenic
1001034453 5:168287485-168287507 TGCTTCTGGACTCCCAGTGTGGG - Intergenic
1002415055 5:179116021-179116043 CTCTGCTGCCCACCCTGTCTCGG + Intronic
1012238361 6:96843845-96843867 CACTGCTGCCCGGCCAGGGTAGG + Intergenic
1013292139 6:108728832-108728854 TGCTGCTGCCTTCCTAGTGCAGG - Intergenic
1016267227 6:142246690-142246712 CCCTGCTGACCTCCCAGTGGTGG + Intergenic
1016468957 6:144354719-144354741 CTCTGCTGACTTCCAAGTGTGGG + Intronic
1018170779 6:161141458-161141480 CGCTGCTTCCCTGGCAGAGTTGG - Intronic
1018746420 6:166765420-166765442 CCCTGCTGCCCGCTTAGTGTGGG + Intronic
1019152873 6:170020427-170020449 CTCAGTTGCCCTCCCAGGGTTGG + Intergenic
1019312023 7:367536-367558 CTCTGCTGCCCTCCTGGTGTGGG - Intergenic
1020089966 7:5333378-5333400 GGCTGCTGCCCTGCAGGTGTGGG - Intronic
1024761223 7:52598251-52598273 AGCAGCTGCCCACCCAGTTTTGG - Intergenic
1025258335 7:57400097-57400119 CCCTGCTGGCCTGGCAGTGTGGG + Intergenic
1026466017 7:70655434-70655456 CTATGCTGCCATCTCAGTGTTGG + Intronic
1026968173 7:74453548-74453570 CCCGGCTGCTCTCCCAGTGGTGG + Intergenic
1027189334 7:75988572-75988594 CTCAGCTGCCCTCCCGGGGTGGG - Intronic
1029258556 7:99285956-99285978 CACTAATGCCCGCCCAGTGTGGG + Intergenic
1029433402 7:100547200-100547222 CGCTGCTGTTCTCCCAGACTTGG + Intronic
1029629079 7:101739315-101739337 CTCTGCTGCCCTACCCGTGGGGG - Intergenic
1030271633 7:107675019-107675041 AGCTGCTGCCTTCCAAGTGCTGG + Exonic
1032649274 7:133859465-133859487 CGCTGCAGCAGTTCCAGTGTGGG - Intronic
1033655867 7:143373855-143373877 CACTCCTGCGCTCACAGTGTAGG + Intergenic
1034245236 7:149638932-149638954 CTGTGCTGACCTGCCAGTGTGGG - Intergenic
1036222658 8:6933793-6933815 TGCAGCTTCCCTCCCAGTGTTGG + Intergenic
1037426059 8:18755930-18755952 CGCTTCTGCCCTCCCCGTGGAGG - Intronic
1040317589 8:46273056-46273078 CCCTGCTGCCCACCCACAGTGGG - Intergenic
1046759810 8:118009522-118009544 CCCTGCTGCAGACCCAGTGTTGG - Intronic
1049255622 8:141612172-141612194 CGCTGCTACCCTCCCAGCCTCGG + Intergenic
1049306340 8:141906285-141906307 CCTCGCTGGCCTCCCAGTGTTGG - Intergenic
1049607048 8:143534611-143534633 CCCTGCTGGCCTCCCAGAGCTGG + Intronic
1049744696 8:144258319-144258341 CCCTGATCCACTCCCAGTGTCGG - Intronic
1052987506 9:34498685-34498707 AGCAGCTGCCTTCCCAGAGTTGG + Intronic
1055240869 9:74184072-74184094 CGCTGCTGCCCTTGGAGTGCTGG - Intergenic
1059408684 9:114118407-114118429 CTCAGCTGCCCTCCCTGTTTGGG + Intergenic
1059413636 9:114149788-114149810 AGGTGCTGCCCTCCCAATGGTGG + Intergenic
1060250492 9:121983071-121983093 CACTGTTGCCATCCCAGTCTAGG - Intronic
1060484892 9:124040853-124040875 CACTGCGGCCGTCCCAGAGTGGG - Intergenic
1060734551 9:126058812-126058834 CTCTGCTGCTCTCCCAGCCTCGG + Intergenic
1061566751 9:131445892-131445914 AGCTGCTGTCCTTCCAGTGGAGG - Intronic
1061790269 9:133055452-133055474 CTTTGCTGCCTTCCCAGTGAGGG + Intronic
1062359255 9:136179811-136179833 GGGGGCTGCCCACCCAGTGTGGG - Intergenic
1203784492 EBV:119891-119913 GGCTGCTGCCGTCCCAGGGCCGG - Intergenic
1186733377 X:12434397-12434419 CTCTGCTCTCCTCTCAGTGTAGG + Intronic
1188483881 X:30661406-30661428 CGCAGCGGCCCTCCTAGTGGAGG + Intronic
1198102042 X:133430483-133430505 TGCTGCTGCTCTCTCAGTTTAGG - Intergenic
1200734827 Y:6782915-6782937 CTCTGCTCTCCTCCCAGTGCTGG - Intergenic
1201317456 Y:12662032-12662054 AGCTGCAGCTATCCCAGTGTTGG + Intergenic