ID: 1097293616

View in Genome Browser
Species Human (GRCh38)
Location 12:57941335-57941357
Sequence TCGCTGCTGCCCTCCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097293616_1097293622 12 Left 1097293616 12:57941335-57941357 CCACACTGGGAGGGCAGCAGCGA 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1097293622 12:57941370-57941392 CCGGGTTGTTACAGCCTTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1097293616_1097293623 13 Left 1097293616 12:57941335-57941357 CCACACTGGGAGGGCAGCAGCGA 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 49
1097293616_1097293619 -6 Left 1097293616 12:57941335-57941357 CCACACTGGGAGGGCAGCAGCGA 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1097293619 12:57941352-57941374 CAGCGAAATCCGCGGCAGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 52
1097293616_1097293618 -7 Left 1097293616 12:57941335-57941357 CCACACTGGGAGGGCAGCAGCGA 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1097293618 12:57941351-57941373 GCAGCGAAATCCGCGGCAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097293616 Original CRISPR TCGCTGCTGCCCTCCCAGTG TGG (reversed) Intergenic
900557329 1:3287117-3287139 TCCATGCTGCCGCCCCAGTGGGG - Intronic
901272340 1:7961927-7961949 TCGCTTCCGGCCTCCCAGTCGGG + Intronic
902845857 1:19110303-19110325 TCCCTCCTCCCCTCCCAGTCCGG + Intronic
903774663 1:25785120-25785142 TCCCTGATGCCCTCCCTGGGAGG + Exonic
905643781 1:39610235-39610257 GCTCTGCTGTCCTCCCTGTGTGG - Intergenic
906943406 1:50275588-50275610 TCCCTGCAGCCTCCCCAGTGCGG + Intergenic
907237830 1:53063476-53063498 TCGCCGCTGCCTTCCCAGTGTGG - Intronic
907387914 1:54137929-54137951 CTGTGGCTGCCCTCCCAGTGGGG + Intronic
908494374 1:64679773-64679795 TGGCTGCTGCCTCCCCTGTGGGG - Intronic
908686410 1:66725091-66725113 ACACTGCTGACCTCCCAGTTTGG - Intronic
909803626 1:79847006-79847028 TTGCTGCTGCTCTTCCAGTCTGG - Intergenic
909958253 1:81803025-81803047 CCGCTGCTGCCCTCTCACTGCGG - Intronic
910204542 1:84735075-84735097 TTGCTGCTGGACTCCCAATGTGG + Intergenic
914675366 1:149904005-149904027 CCCCTGCTCCCCTCCCTGTGAGG + Exonic
915524189 1:156466137-156466159 TCCCTGCTGCCTCCTCAGTGGGG - Exonic
922743827 1:228031911-228031933 TCGCTGCTTCCTTCTCAGAGGGG - Intronic
922814096 1:228437022-228437044 TCCCTCCTGCTCTCCCTGTGCGG + Intergenic
923209638 1:231791852-231791874 TTGCTGCTGCCATCACACTGTGG - Intronic
923621524 1:235583221-235583243 TTGCTGCAGTCCTCCCAGCGTGG + Intronic
1063131861 10:3185303-3185325 TCTCTGCTGCTCTGCCAGTGAGG - Intergenic
1064237152 10:13587012-13587034 TCGCGGCCGCCGGCCCAGTGAGG + Exonic
1065388700 10:25159754-25159776 GCTCTGCTACTCTCCCAGTGGGG + Intergenic
1065390150 10:25174890-25174912 TCGCGGCTGCGCTCGCGGTGCGG + Intergenic
1065754028 10:28914224-28914246 TAGCACCTGCCCTACCAGTGGGG + Intergenic
1067698642 10:48553107-48553129 CCTCTGCTCCCCTCCCACTGGGG - Intronic
1069262427 10:66415062-66415084 GCCCTGCTGCCCTGCCAGTGGGG - Intronic
1069994049 10:72332009-72332031 TCCCCCCTGCCCTCCCTGTGTGG - Intergenic
1070559022 10:77551929-77551951 TCACTTCTGGCCTTCCAGTGGGG - Intronic
1072622628 10:97090137-97090159 TCCATGCTTCCATCCCAGTGGGG + Intronic
1073154569 10:101336235-101336257 TGGCTGCTGCCCTGGCACTGGGG + Intergenic
1073704471 10:105967466-105967488 TAAGTGCTGCCCTCCCTGTGGGG - Intergenic
1075527795 10:123200802-123200824 TGGCTGCTGCCCACCCACTTTGG - Intergenic
1076821765 10:132943198-132943220 GCGCTGCTACCCTCTCCGTGGGG - Intergenic
1076875862 10:133215225-133215247 TCCCTGCTGCTGTCCCAGAGTGG + Intronic
1077236922 11:1486321-1486343 CCGTGGCTGCCCTCCCAGTGTGG - Intronic
1077410950 11:2403662-2403684 ATCCTGCTGCCTTCCCAGTGGGG + Exonic
1079094852 11:17503577-17503599 TCCCTGCTTCTCTCCCTGTGAGG + Intronic
1080075206 11:28140060-28140082 TCCCTGCTTCCCTCCCAGCTAGG - Intronic
1083756069 11:64792271-64792293 TGCCTGCTCCCCTGCCAGTGCGG - Exonic
1084571389 11:69962178-69962200 TCACTGCAGCCCTCCCAGGCAGG + Intergenic
1087180060 11:95133105-95133127 TCTTGGCTGCCTTCCCAGTGTGG + Intergenic
1091448131 12:556486-556508 ACCGTGCTACCCTCCCAGTGTGG + Intronic
1091796347 12:3299438-3299460 TCCCTGCTGCCCTCCAGGTTTGG - Intergenic
1092002790 12:5045268-5045290 TGGCTGCTGCTCTGCCAGTTCGG - Exonic
1092558024 12:9578066-9578088 ACCCTCCTGCCCTGCCAGTGTGG + Intergenic
1094513273 12:31109851-31109873 ACCCTCCTGCCCTGCCAGTGTGG - Intergenic
1097183262 12:57183134-57183156 TCTCTGCTGCCCTCTCATGGTGG + Intronic
1097293616 12:57941335-57941357 TCGCTGCTGCCCTCCCAGTGTGG - Intergenic
1100037784 12:90274792-90274814 TCCCTGCAGCCCTCCCAGTGGGG + Intergenic
1100868027 12:98878483-98878505 CTGCTGCTCCCCTACCAGTGAGG + Intronic
1102476320 12:113191216-113191238 CTGCTGCTGCCATCCCAGGGTGG + Intronic
1104901488 12:132191773-132191795 TCCCTGCAGCCCTCTCAGAGGGG + Intergenic
1105978532 13:25495159-25495181 CTGCTGCTGCCCTTCCAGGGTGG + Intronic
1106118603 13:26838582-26838604 TGGTTGCTCCCCTCCCACTGAGG - Intergenic
1108496952 13:51034688-51034710 TCTCTCCTGACCTCCCTGTGAGG + Intergenic
1108770762 13:53698013-53698035 TGGCTGCTGACTTACCAGTGTGG - Intergenic
1110013014 13:70363212-70363234 TCTCTGCTGTCCTGCCTGTGAGG + Intergenic
1112505202 13:99971010-99971032 CCGCTGCTCCCCTCCGAGCGGGG + Exonic
1113947148 13:114050784-114050806 TAGCTGCCGGCCGCCCAGTGGGG + Intronic
1116429662 14:44831196-44831218 TTGCTAGTGCCCTCCCACTGTGG + Intergenic
1117018869 14:51549102-51549124 TGGCTGCTGCCCTCACAGCCTGG - Intronic
1117620723 14:57583580-57583602 TCCCAGCTGCTCTGCCAGTGAGG - Intronic
1118734554 14:68692038-68692060 TCTCTCCTGCCCTCACAGTCAGG + Intronic
1118806424 14:69241101-69241123 TAGCTGCTTTCCTCCCAGTTAGG + Exonic
1120345351 14:83282028-83282050 ATGCTGCTGCTCTCTCAGTGTGG - Intergenic
1121655716 14:95594168-95594190 TTGCTGCTTGACTCCCAGTGGGG + Intergenic
1122575577 14:102739518-102739540 CTGCTGCTACCCTCCCTGTGTGG - Intergenic
1124063330 15:26316609-26316631 TCTCTGTTGCCCTCCCAGCCTGG + Intergenic
1124604594 15:31161030-31161052 CCGCTCCTGCCCACCCAGGGAGG - Exonic
1128249166 15:66152723-66152745 CCCCTGCTGTCCTCCCACTGTGG + Intronic
1128747120 15:70122621-70122643 TCTCTGCTGCCCAGCCAGTCAGG + Intergenic
1130047462 15:80456771-80456793 GAGCTGCTGGCCTCCCAGTAAGG - Intronic
1132221212 15:100106940-100106962 TCACTGCCTCCCTCCCCGTGAGG + Intronic
1132334542 15:101037575-101037597 ACACTGCTGCCCTGCCACTGGGG + Intronic
1132781471 16:1628754-1628776 TTGCTGCACCCCTCCCAGGGAGG - Intronic
1133779765 16:8928909-8928931 TGGCTGCTGCCCTCCACTTGCGG - Intronic
1135435807 16:22425909-22425931 TCACTGCTGCTCTCCAAGTGAGG - Intronic
1138208189 16:55140677-55140699 TCTCTCCTGCCTTCACAGTGGGG + Intergenic
1139307749 16:66002052-66002074 TCTCTGCAGCCCTACCAGTAAGG + Intergenic
1141392355 16:83675401-83675423 TCGCTGCTCCCCTCCCTCTGTGG + Intronic
1142045019 16:87919739-87919761 TCACTGCTGCTCTCCAAGTGAGG - Intronic
1142066496 16:88065889-88065911 TGGCTGGGGCCCTCCCAGAGGGG - Intronic
1142115379 16:88353542-88353564 TCACTGCTGCCTGCCCAGAGAGG + Intergenic
1142812703 17:2402589-2402611 TCGCTGCCGCTGTACCAGTGGGG - Intergenic
1143632277 17:8146173-8146195 TCTCTCCTGACTTCCCAGTGGGG - Intronic
1145055155 17:19698032-19698054 TTGTTGCAGCCATCCCAGTGGGG - Intronic
1147705504 17:42422516-42422538 GCGCTGCTCCCCTCCCAGCCTGG - Intronic
1147993962 17:44351345-44351367 TCTCTGCTTCCCTCACAGTGGGG + Exonic
1148683000 17:49485438-49485460 CCTCTCCTGCTCTCCCAGTGCGG - Intergenic
1149651395 17:58278616-58278638 TTGGGGCTGCCCTCTCAGTGGGG + Intronic
1151703473 17:75755176-75755198 GCGCTGCTGGCCTCCCAGCCAGG - Intronic
1153115665 18:1652611-1652633 TCCCAGCTCCCCTCACAGTGGGG - Intergenic
1153591269 18:6675974-6675996 TCCCTGCTCCCCTCCCTGGGTGG + Intergenic
1156270303 18:35524379-35524401 TTGCTCCTGCCTTCCCTGTGAGG - Intergenic
1156499814 18:37550621-37550643 TCTTTGCTGGGCTCCCAGTGGGG - Intronic
1157158918 18:45295062-45295084 TAGCTGCTGCCCTTGAAGTGTGG - Intronic
1157201145 18:45660971-45660993 GAGCTGCTGCCCTCCCTGGGTGG + Intronic
1159919178 18:74212433-74212455 TGTCTGCTGCCCTCCCAGCTCGG - Intergenic
1160313589 18:77820616-77820638 CCGGGGCTGCCCTCTCAGTGGGG - Intergenic
1161197483 19:2995011-2995033 TCGCTGCTGTCATCCCACTCCGG + Exonic
1161260791 19:3336795-3336817 TGGCTGCCTCCCTCCCCGTGGGG - Intergenic
1161262759 19:3346684-3346706 GTCCTGCTGCCCTCCCAGTGGGG + Intergenic
1162087123 19:8255616-8255638 TCTCTCCTGGCCGCCCAGTGTGG + Exonic
1162954425 19:14090450-14090472 GCGCTGCCTCCCTCCCAGCGCGG + Exonic
1163322465 19:16582695-16582717 TAGGTGCTGCCCTCCCCCTGTGG - Intronic
1166001787 19:39881814-39881836 CCGCAGCTGGCTTCCCAGTGAGG + Intronic
1166004568 19:39898065-39898087 CCGCAGCTGGCTTCCCAGTGAGG + Intronic
1167381337 19:49139943-49139965 TCTCTCCTGCTTTCCCAGTGAGG + Exonic
1168197528 19:54786698-54786720 TGGGTGCTGACCACCCAGTGAGG - Intronic
1168241500 19:55091321-55091343 ACTCTGCTCCCCTCCCAGTCCGG + Exonic
927980305 2:27370693-27370715 CCGCTGCGGCCCTCACAGTCCGG + Exonic
931223070 2:60305823-60305845 TTGGTCCTGCCCTCCGAGTGAGG - Intergenic
931257504 2:60585937-60585959 TCACTGCTGGACACCCAGTGGGG - Intergenic
931763790 2:65437164-65437186 TGGTTTCTGCCCTCCCAGGGAGG + Intergenic
932592812 2:73077229-73077251 TCTGTGCTGCCCTAGCAGTGAGG + Intronic
935635934 2:105249879-105249901 CAGATGCTGACCTCCCAGTGAGG - Intergenic
937292584 2:120790548-120790570 TTGCGGTTCCCCTCCCAGTGTGG + Intronic
938064177 2:128272182-128272204 TACCTGCTGCCCTCCCGATGTGG + Intronic
939037439 2:137149531-137149553 TCCTGGCTGCCCTCACAGTGTGG - Intronic
940128127 2:150350610-150350632 TGGCTGCTGTAATCCCAGTGTGG + Intergenic
941639231 2:167969682-167969704 CCGCTGCTGCTCCCCAAGTGAGG + Intronic
941674440 2:168328773-168328795 GCACTGCTGCCCTGCCACTGGGG - Intergenic
942557611 2:177187913-177187935 TGGCTGCTGCCATGCCAGTCAGG - Intergenic
1169353847 20:4891659-4891681 TGCCTCCTTCCCTCCCAGTGGGG + Intronic
1170871502 20:20210594-20210616 TCGCTGCTGTCATCCTAGTGGGG - Intronic
1172569044 20:35954586-35954608 CGGCTGCTGCCCTCGCGGTGCGG + Exonic
1172894678 20:38292207-38292229 TCTCTCCTGCCCTCCCAGGAAGG - Intronic
1173003385 20:39121684-39121706 GAGCTGCTGCCATTCCAGTGGGG - Intergenic
1173043973 20:39491881-39491903 TACATGCTGCTCTCCCAGTGTGG + Intergenic
1173159859 20:40644376-40644398 GCTCTGCTGCCTTCCTAGTGGGG + Intergenic
1174503206 20:51000524-51000546 TCTCTGTTGCCATCCCTGTGTGG + Intergenic
1175413694 20:58787630-58787652 TCGCCGCAGCCCTGCCACTGAGG - Intergenic
1176125773 20:63473805-63473827 TCAGTGCTGCCCGCCCTGTGAGG + Intergenic
1182159110 22:28104133-28104155 TCTCTCCTGGCTTCCCAGTGGGG + Intronic
1182911387 22:33987451-33987473 TCTCTCTTCCCCTCCCAGTGGGG + Intergenic
1184147914 22:42622395-42622417 CCGCAGCTGACCTTCCAGTGGGG - Intronic
1184648393 22:45908336-45908358 TGGCTGCTGCTCTGCCTGTGGGG - Intergenic
1184700848 22:46171640-46171662 ACCCTGCTGCCCTCCCTGTCAGG - Intronic
1184770331 22:46593440-46593462 TCCCACCTGCCCTCCCTGTGCGG - Intronic
950461675 3:13125846-13125868 CCGGTGTTCCCCTCCCAGTGCGG + Intergenic
952287180 3:31980724-31980746 TCCCTGCTCCCCTCCAGGTGGGG - Intronic
953220743 3:40969525-40969547 TCACTGCAGCCCTCCTAGGGAGG + Intergenic
954142664 3:48617355-48617377 TCTCTGATGTCCTCCAAGTGAGG - Intergenic
954384812 3:50238441-50238463 TGGCTGCTGCCAGCCCAGTGTGG - Intronic
954389850 3:50262949-50262971 TTGCTGCTTCCCCCACAGTGGGG + Intergenic
954431802 3:50474856-50474878 GCTCTGCTGGCCTCCAAGTGCGG + Intronic
954434415 3:50488497-50488519 TCTCTGCTGCCCTCACCCTGGGG - Intronic
954457839 3:50609581-50609603 TCCCTGCTGCCCTCCCAAGGAGG - Intronic
957244682 3:77702219-77702241 TCTCTGCTGCTCTGACAGTGGGG - Intergenic
959031771 3:101308130-101308152 TCCCAGCTGCCTTCACAGTGTGG + Intronic
966097403 3:176220685-176220707 TTGCTGCAGAGCTCCCAGTGTGG - Intergenic
967104246 3:186242462-186242484 GCGCTGCCACCCACCCAGTGTGG - Intronic
967701166 3:192593777-192593799 TTGCTTCTGCCCTCCCTCTGAGG + Intronic
967867727 3:194204124-194204146 TCGCTGCTGCCCTCGCTGTCAGG - Intergenic
968548636 4:1211181-1211203 ACACTGCTTCCCTCCCACTGGGG + Intergenic
970558416 4:17258999-17259021 CCGCTGAGGCCCTCCCTGTGTGG + Intergenic
972175296 4:36397225-36397247 AAGCTGCTTCCCTTCCAGTGGGG + Intergenic
972802366 4:42490335-42490357 TAGATCCTGCCCTCGCAGTGAGG - Intronic
973572888 4:52258305-52258327 TTGCTGCTGCCCACCCAGCTTGG + Intergenic
975594586 4:76037064-76037086 TGGCTGCTGCCCTCCAATGGTGG + Intronic
977984847 4:103370954-103370976 TTGCAGCTGCTTTCCCAGTGAGG + Intergenic
980103927 4:128568917-128568939 TCTCTGCTTCCCTTACAGTGTGG - Intergenic
981355318 4:143783474-143783496 TTAGTGCTGCCCTCACAGTGAGG + Intergenic
983937873 4:173515676-173515698 TGGCTGCTGCCCTCACAGGTGGG - Intergenic
984101727 4:175495309-175495331 TGGCTGCTGTCCTCACGGTGAGG - Intergenic
986319392 5:6615673-6615695 CTGCTGCTGTCCTTCCAGTGAGG - Intronic
986807696 5:11324175-11324197 TCCCTGCTGCCCTCACCATGAGG - Intronic
988444899 5:31274775-31274797 TCGCTACTGCACTCCCAGCCTGG + Intronic
988925918 5:35991078-35991100 TCGCTGGAGCCCTGGCAGTGCGG + Intronic
995595683 5:113745543-113745565 ATGTTCCTGCCCTCCCAGTGGGG + Intergenic
998176395 5:139904512-139904534 TCGCTGCTCCCCTCCCCCGGAGG - Intronic
998532993 5:142902504-142902526 TCCGTGCTTCGCTCCCAGTGTGG + Intronic
1000954822 5:167530738-167530760 TCGCTGCCGTCCTTTCAGTGGGG + Intronic
1001034454 5:168287486-168287508 TTGCTTCTGGACTCCCAGTGTGG - Intergenic
1001441801 5:171749406-171749428 TGGCTGCTGCCCTCCAAGGCAGG - Intergenic
1002932584 6:1644637-1644659 TCCCTGCTGCCCGCCCAGGAAGG + Intronic
1005306372 6:24517933-24517955 TGGCTGCTGTCCTCTCAGCGGGG - Intronic
1005650783 6:27882987-27883009 TCACTGCTGCACTCCCACTAGGG + Intergenic
1007324342 6:41048730-41048752 TCTCTGCTCCCTTCCCAATGAGG + Intronic
1010274037 6:73948573-73948595 ATGCTGCTGCCCTGCCACTGTGG + Intergenic
1011621340 6:89245686-89245708 TCTCTGCTTGCCTCCAAGTGAGG + Intergenic
1013684726 6:112566053-112566075 TCCTTGATGCCCTCCCTGTGAGG - Intergenic
1016468956 6:144354718-144354740 TCTCTGCTGACTTCCAAGTGTGG + Intronic
1018746418 6:166765419-166765441 TCCCTGCTGCCCGCTTAGTGTGG + Intronic
1018931359 6:168242293-168242315 TGGCTGCTGCCCTCTCCATGGGG - Intergenic
1019023153 6:168935873-168935895 TCGCTGCTGCCCTCTGAGCCTGG + Intergenic
1019312024 7:367537-367559 ACTCTGCTGCCCTCCTGGTGTGG - Intergenic
1019780290 7:2935798-2935820 CAGCTGCTGGCCTCCCACTGGGG - Intronic
1020402571 7:7795554-7795576 TCGCAGCTGCTCTGCCTGTGGGG - Intronic
1027063192 7:75102535-75102557 TCGCAGCTGTAATCCCAGTGTGG + Intronic
1027238896 7:76314485-76314507 CCCCTGGTGCCCTCCCAGAGAGG + Intergenic
1029629080 7:101739316-101739338 TCTCTGCTGCCCTACCCGTGGGG - Intergenic
1032125363 7:129189153-129189175 TGGCCGCTGCCCGCCCAGCGCGG + Exonic
1032137589 7:129294891-129294913 TCTATTCTGCCTTCCCAGTGGGG + Intronic
1032536907 7:132672106-132672128 TCCCCGCAGCCCTCCCTGTGTGG + Intronic
1035870627 8:3133216-3133238 TGGCTGCTGCTGTCCCAATGGGG + Intronic
1038644596 8:29351295-29351317 GCGCTGCTGCCCACCCAGCGGGG + Intergenic
1040317591 8:46273057-46273079 TCCCTGCTGCCCACCCACAGTGG - Intergenic
1040455744 8:47595546-47595568 TCCCTTGTGCCCTCCCAGTATGG - Intronic
1044067585 8:87718258-87718280 TAGCTTCAGCACTCCCAGTGGGG - Intergenic
1045504443 8:102768646-102768668 TCCCTGCTGCCCTCACAGCCAGG - Intergenic
1047202030 8:122775520-122775542 TCCCTGCTTCCCTCTAAGTGAGG - Intergenic
1048769754 8:137882909-137882931 TCGCAGCTGCCTTCACAGTCTGG - Intergenic
1049041674 8:140116786-140116808 TCGCTGCTGCCCCACCTGTAGGG - Intronic
1049268484 8:141681960-141681982 TCTCTGCTTCCCTTCAAGTGGGG + Intergenic
1049776847 8:144409845-144409867 TCACTGCTGCCTACCCAGGGCGG + Intronic
1052832785 9:33229462-33229484 TCTCTGCTGCCCTCTCCCTGTGG - Intronic
1053294284 9:36901823-36901845 TCCCTGCTGCCCTCCCAAGATGG + Intronic
1054907700 9:70425214-70425236 CTGCTGCTGTCCTCACAGTGGGG + Intergenic
1056270757 9:84946015-84946037 TCGGTGCTTCTCTCCCTGTGGGG - Intronic
1059076326 9:111197326-111197348 ATGCTGATGTCCTCCCAGTGAGG - Intergenic
1059348070 9:113645769-113645791 TCGCCGCTGCCCTCCCTGGCAGG - Intergenic
1060011225 9:120044392-120044414 TCACTGCTGTCCTCCCAGCATGG - Intergenic
1060720019 9:125970420-125970442 TGACAGCTGCCCTCCCAGGGAGG - Intergenic
1061726142 9:132582915-132582937 TCGCTGCTGCTCTCTGAGCGTGG - Exonic
1061744273 9:132728204-132728226 TCCCTGGTGACCTCCAAGTGTGG - Intronic
1061790268 9:133055451-133055473 CCTTTGCTGCCTTCCCAGTGAGG + Intronic
1062043451 9:134414667-134414689 GCACTGCTGTCTTCCCAGTGGGG - Intronic
1062102729 9:134737022-134737044 TCCTTGCTGCCCTCCCAGGCTGG + Intronic
1062168864 9:135123008-135123030 GCGCTGCTTTCCTGCCAGTGAGG - Intergenic
1062384519 9:136303889-136303911 TCGCTGCTGCCTTCACATGGCGG + Exonic
1186502687 X:10064774-10064796 GCCCTGCTGCCCTCCCAGGCAGG + Intronic
1190108341 X:47574223-47574245 GCGCTGCTGCCCGCCCGGTGGGG + Exonic
1194973355 X:100368432-100368454 TCTCTGCTCCCCACCAAGTGTGG - Intronic
1197479574 X:126966018-126966040 TCCCTGCTCCCCTCCCAGCCAGG + Intergenic
1198871611 X:141181445-141181467 TCTCTATTGCCCTCCAAGTGAGG - Intergenic