ID: 1097293623

View in Genome Browser
Species Human (GRCh38)
Location 12:57941371-57941393
Sequence CGGGTTGTTACAGCCTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097293616_1097293623 13 Left 1097293616 12:57941335-57941357 CCACACTGGGAGGGCAGCAGCGA 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 49
1097293615_1097293623 14 Left 1097293615 12:57941334-57941356 CCCACACTGGGAGGGCAGCAGCG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097293623 Original CRISPR CGGGTTGTTACAGCCTTTGA GGG Intergenic
906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG + Intergenic
907984494 1:59517197-59517219 CAGGTTGTTATTGCCTTTCAGGG - Intronic
908443340 1:64177561-64177583 GGGGTTGTTATAGTCTTTCAAGG - Exonic
910746607 1:90581582-90581604 AGGGTTGTTCCTGCCTATGATGG - Intergenic
1064956089 10:20911881-20911903 CTGCTTTTTAGAGCCTTTGACGG - Intronic
1067373554 10:45706887-45706909 CAGGTGGTTACAGCCTGCGATGG + Intergenic
1067380135 10:45765332-45765354 CAGGTGGTTACAGCCTGCGATGG - Intronic
1082937875 11:58673389-58673411 CATGTTTGTACAGCCTTTGAGGG - Intronic
1090259204 11:125306478-125306500 CTGGTAGTACCAGCCTTTGATGG - Intronic
1092134864 12:6139913-6139935 CCAGTTGTTACAGCCTATAAAGG + Intergenic
1097157973 12:57026583-57026605 TGGGTTGTTTCAGCCTCTGAGGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1097356632 12:58609437-58609459 CAGGTTGTTACTGCTTTTGGGGG + Intronic
1098072273 12:66688804-66688826 AGGGTTGTTTCCTCCTTTGAAGG - Intronic
1104136265 12:125941974-125941996 AGGATTTTTACATCCTTTGAAGG + Intergenic
1106950813 13:34881478-34881500 CGTGTTGTTACAACCTAGGAAGG - Intergenic
1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG + Intergenic
1122100901 14:99408926-99408948 GGGGTCCTTACAGCCTTGGAAGG - Intronic
1127046297 15:55029102-55029124 CAGCTGGTTACAGCATTTGATGG + Intergenic
1132617933 16:851627-851649 CGGGTTGTGACAGCCTCGGCTGG - Intergenic
1134790202 16:16982826-16982848 CAGTTGGTTACACCCTTTGAAGG - Intergenic
1138954034 16:61949544-61949566 CGGAGTGTTACAGCTTTTAAAGG - Intronic
1152487441 17:80603440-80603462 GGGGTTGGTGCATCCTTTGAAGG + Intronic
1158089272 18:53691757-53691779 GGGGTTGTTATAGAATTTGAGGG - Intergenic
1161284539 19:3462592-3462614 CAGGTTGTTAGAGCCTGGGATGG + Intronic
938560224 2:132465641-132465663 AAGGTTGTCACAGCGTTTGAAGG + Intronic
945732355 2:213554180-213554202 AGTGTTGTTAGAGTCTTTGATGG - Intronic
1168920989 20:1536165-1536187 CTGGTTGTTACAGCCTTTTAGGG - Intronic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
955160287 3:56458756-56458778 GGGAATGTTACAGCCTTAGAAGG + Intronic
955365377 3:58306086-58306108 CGGGTTTTTTCCGCCTTGGACGG - Intergenic
959027659 3:101259197-101259219 TGGGTTCTTACTGCCTATGATGG - Intronic
968976427 4:3824515-3824537 CGGGTAGAGAAAGCCTTTGAAGG - Intergenic
987017683 5:13836970-13836992 AGGGCTGTTCCAGCCTCTGAAGG - Intronic
995756002 5:115504819-115504841 CTGGTGGTTACAGCCTTAGTGGG - Intergenic
998612810 5:143707497-143707519 TGGGTTGTTACCTCATTTGAAGG + Intergenic
999145820 5:149392872-149392894 GTGGTTGTTTCAGCCTTAGAGGG - Intronic
1002848002 6:965976-965998 CGGGTAGTTACAGCCTCACAGGG - Intergenic
1008179816 6:48314599-48314621 AGGGGTGTTCCAGCTTTTGAGGG + Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1012938756 6:105395777-105395799 TGGATTTCTACAGCCTTTGATGG - Intronic
1019177613 6:170168197-170168219 CGGGTTGTTACTGCCTGTTCAGG + Intergenic
1019177747 6:170168992-170169014 CGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177848 6:170169548-170169570 GGGGTTGTTACAGCCTATTTGGG + Intergenic
1019438250 7:1032656-1032678 CGGGTGGCTGCAGCCTCTGAGGG - Intronic
1030261597 7:107570618-107570640 CACCTTGTTACAGCCTTTGGAGG + Intronic
1035096218 7:156357982-156358004 AGGGTTGTATCAGCATTTGAGGG - Intergenic
1045108992 8:98921574-98921596 CAAGTTGTTACAGCCTATGATGG + Intronic
1050245615 9:3686657-3686679 CGGGTTGCTAAAGACTTTGGTGG + Intergenic
1050607545 9:7317227-7317249 CGGGTTGGTATAGTGTTTGATGG - Intergenic
1051107779 9:13599755-13599777 CTGGTTGTTACAGGGGTTGAGGG - Intergenic
1051328730 9:16000888-16000910 CGCAGAGTTACAGCCTTTGATGG + Intronic
1057298467 9:93862749-93862771 CGCGGTGTTACAGCTTTTAAAGG + Intergenic
1201543512 Y:15134787-15134809 CGGGTTGTTAAAGTCTTTTATGG - Intergenic