ID: 1097293623

View in Genome Browser
Species Human (GRCh38)
Location 12:57941371-57941393
Sequence CGGGTTGTTACAGCCTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097293615_1097293623 14 Left 1097293615 12:57941334-57941356 CCCACACTGGGAGGGCAGCAGCG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 49
1097293616_1097293623 13 Left 1097293616 12:57941335-57941357 CCACACTGGGAGGGCAGCAGCGA 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097293623 Original CRISPR CGGGTTGTTACAGCCTTTGA GGG Intergenic