ID: 1097294427

View in Genome Browser
Species Human (GRCh38)
Location 12:57947298-57947320
Sequence CAAGCTAAACCATTTTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097294423_1097294427 24 Left 1097294423 12:57947251-57947273 CCTTACAGGAAAGATAAGACATG 0: 1
1: 0
2: 3
3: 16
4: 222
Right 1097294427 12:57947298-57947320 CAAGCTAAACCATTTTAGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097294427 Original CRISPR CAAGCTAAACCATTTTAGGT GGG Intronic
902017095 1:13317363-13317385 CAAACTGAACCATTTTGGCTGGG - Intronic
907646210 1:56246227-56246249 CAAGTTAAACCATCATAAGTTGG - Intergenic
908155493 1:61348545-61348567 CAAGCTAAGCCCGTTTATGTGGG + Intronic
910813435 1:91262631-91262653 CAAGAAAAACCATTTTAATTTGG + Intronic
911286395 1:95998826-95998848 GAAGCTAAAAAATTTTAGGCAGG + Intergenic
911587310 1:99705432-99705454 TAAGATAATCCATTATAGGTTGG - Intergenic
913441252 1:118900256-118900278 GAAGCTAATCCATTTCAGGAAGG - Intronic
919887507 1:201945646-201945668 AAAGCTAAGCCATTTTTTGTGGG - Intronic
921559782 1:216643518-216643540 CAAGCTAAAGGATTTAAGCTGGG + Intronic
924785456 1:247193184-247193206 CCAGCTCAACAATTTTAGTTGGG - Intergenic
1068003868 10:51369902-51369924 CAGGCTATCCCATTTTAGCTGGG - Intronic
1068716320 10:60192941-60192963 CAATTTAAACCATTGTAGCTAGG + Intronic
1070095199 10:73330832-73330854 CAGGCTAAAACATTTTAAGAAGG + Intronic
1070642132 10:78177760-78177782 TAAGCGACACCATTTTAGGAAGG - Intergenic
1071163175 10:82776191-82776213 TTGGCTATACCATTTTAGGTTGG + Intronic
1072834117 10:98692902-98692924 CAAACAAAAACACTTTAGGTGGG + Intronic
1074538220 10:114344179-114344201 CAAGCTAAGGCCTTTTAGTTGGG - Intronic
1074963080 10:118465244-118465266 CAAAAGAAACCATTTTAGCTAGG + Intergenic
1075256764 10:120931458-120931480 CAAGTTATACCATTTTGGTTTGG + Intergenic
1079249422 11:18776246-18776268 CATCCTAAAGCATTATAGGTAGG - Intronic
1079311876 11:19373659-19373681 CATGCAATATCATTTTAGGTAGG - Intronic
1080446600 11:32343751-32343773 ATAGCTCAACCATATTAGGTAGG + Intergenic
1081494415 11:43593528-43593550 GATGCTAAACCATTTTAGTTGGG - Intronic
1082929262 11:58582063-58582085 AATGCTAAAGCATTTTAGCTTGG + Intronic
1083918909 11:65769744-65769766 CATGCAAAACCATTTTGGGTGGG - Intergenic
1084279233 11:68076262-68076284 CAAGCTAATGAATTTTAGGGTGG + Intronic
1086520899 11:87666614-87666636 CATGCTAAACATTTTTAAGTAGG + Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091854265 12:3726424-3726446 TAAACTTAACCATTATAGGTAGG - Intronic
1092073215 12:5650240-5650262 TAAGCTAAACCAGATTAGGAAGG + Intronic
1092761400 12:11814302-11814324 AAAGATAAAACATTTTAAGTTGG - Intronic
1093779453 12:23118476-23118498 CATGTTAAACCTTTTTAGGTTGG - Intergenic
1095904576 12:47364738-47364760 CAAACTAAACTGTTTTAAGTAGG + Intergenic
1097294427 12:57947298-57947320 CAAGCTAAACCATTTTAGGTGGG + Intronic
1097309710 12:58105263-58105285 GAAGCTAATCCATTTTAGAGTGG + Intergenic
1097397285 12:59091397-59091419 TTAGCAAAACCATTTTAGTTGGG - Intergenic
1098308426 12:69124289-69124311 TAGGCCAAACCATTTTAGGTTGG - Intergenic
1100002096 12:89849597-89849619 TAGGCTAAGCCTTTTTAGGTAGG - Intergenic
1100445461 12:94656015-94656037 CAAGCCAAAGCATTTTAAGGTGG - Intergenic
1100774811 12:97962453-97962475 TAAGCTGAACCATTGTAAGTTGG + Intergenic
1105343915 13:19556132-19556154 CACGCTTAACCATTTGAGCTGGG + Intergenic
1105507711 13:21024467-21024489 AAAGTTAACCCTTTTTAGGTTGG + Intronic
1105536121 13:21265458-21265480 CACGCTTAACCATTTGAGCTGGG - Intergenic
1105801985 13:23914018-23914040 CAAGTTGAACCATTGTAAGTTGG + Intergenic
1106224150 13:27772595-27772617 CAGGCAAATCCATTTTAGGGTGG - Intergenic
1106341230 13:28829064-28829086 CAAAATAAACCATTTTAGAATGG + Intronic
1109073534 13:57803376-57803398 CAAGCTAAACCACTTGAGTTAGG - Intergenic
1111383478 13:87492001-87492023 TAAAATTAACCATTTTAGGTAGG + Intergenic
1112276974 13:98030129-98030151 AAAGTTAAATCATTTTAGCTGGG + Intergenic
1116169170 14:41376484-41376506 CAGGCTAAACTATTTCAGGTAGG - Intergenic
1117300610 14:54422461-54422483 CAAGTTGAACCATTGTAGATTGG - Intergenic
1130287905 15:82570978-82571000 GAAGCAAAACACTTTTAGGTGGG - Intronic
1134688749 16:16177009-16177031 CAAGCTACACCATGCTAGCTAGG - Intronic
1135669934 16:24366736-24366758 CAAGCGGAAACATTTCAGGTAGG - Intergenic
1135728823 16:24877551-24877573 TAAGATAAAGCTTTTTAGGTTGG + Intronic
1137268189 16:46885365-46885387 GGAGGGAAACCATTTTAGGTAGG + Intronic
1138296607 16:55891157-55891179 CAGGCTAAACCATTTCTGATTGG - Intronic
1139218162 16:65150000-65150022 CAATTTAAACCATTTTAGATGGG - Intergenic
1139331695 16:66197202-66197224 TAAGCTGAACCATTGTAAGTTGG - Intergenic
1153246846 18:3080690-3080712 AAAGCTAAAAGCTTTTAGGTAGG - Intronic
1155367214 18:25060573-25060595 TAAGCTGAACCATTGTAAGTTGG + Intergenic
1155708436 18:28845851-28845873 CAAGTTAAAACATTTTACATAGG - Intergenic
1155865707 18:30962481-30962503 GGAGCTAAACCATGTTAGGAAGG - Intergenic
1156604354 18:38648418-38648440 CAAGCTAAACCATTCGTGCTGGG + Intergenic
1156945464 18:42824954-42824976 CAAGCTAAAAAATATTAGATTGG + Intronic
1158374236 18:56845710-56845732 GAAGCTAATCCATTTTAAATTGG - Intronic
1159886918 18:73917212-73917234 CAAACTAAACCATTGTTGGGTGG + Intergenic
1162101886 19:8343666-8343688 CAAGGGAAAGCATTTCAGGTAGG - Intronic
1162348112 19:10132919-10132941 CAAGCAAAACCTCTTTAGTTGGG - Intergenic
1162450598 19:10752017-10752039 CAATCTAAACCAATTTTGGTTGG + Intronic
1163088338 19:14999686-14999708 CAAGTTGAACCATTGTAAGTTGG - Intronic
1166021121 19:40030548-40030570 TAAGTCAAACCATTTTAAGTTGG + Exonic
924998023 2:381886-381908 TAAGTGAAACCATTTTACGTTGG + Intergenic
926698857 2:15789235-15789257 CAAGCTCCACCATTCTAGGCAGG - Intergenic
926789712 2:16557557-16557579 CACGGTAAACCATTTGAGATGGG - Intronic
929401881 2:41592331-41592353 CAAAATAAAACATTTAAGGTTGG + Intergenic
930344599 2:50164285-50164307 CAAACTAAATCATTTTAACTTGG - Intronic
932899504 2:75681730-75681752 CAAGCTGAAGCATCTCAGGTTGG - Intronic
935253355 2:101285192-101285214 AAAGATAAACAATTTTAGGCTGG - Intronic
935317247 2:101847572-101847594 AAAGCTAAAACATTTTAATTAGG + Intronic
935797820 2:106662783-106662805 AAAGCCAAACCATATTAGGGGGG - Intergenic
938046302 2:128124290-128124312 CAGGTTATACAATTTTAGGTTGG + Intronic
939245793 2:139621833-139621855 TAAGCTGAACCATTGTAAGTTGG - Intergenic
941361521 2:164557562-164557584 CTGGCTAACCCATTGTAGGTAGG - Intronic
941373373 2:164695910-164695932 CAAACCAAACTATTTCAGGTTGG - Intronic
944181733 2:196903299-196903321 CAAGCTAAGCCTTTTTAAGCTGG - Intronic
944958086 2:204835642-204835664 CAAGTCAAACCATTTTAAGTTGG - Intronic
944970076 2:204982643-204982665 CAAGCTAAAAGATTTTAATTAGG + Intronic
947300773 2:228686314-228686336 CAAGGTATAGAATTTTAGGTTGG - Intergenic
1170796496 20:19552046-19552068 GAAACTAAACTCTTTTAGGTGGG - Intronic
1172216708 20:33240715-33240737 CAAGCTAACCAATTTTATGCTGG + Intronic
1173743773 20:45420833-45420855 CAAGCTCTACGATTTTGGGTAGG + Intronic
1177409551 21:20712068-20712090 CATGCTAAACAAATGTAGGTAGG + Intergenic
1178203237 21:30432142-30432164 CAATGCAAACCATTTTATGTTGG - Intergenic
1178834221 21:36082964-36082986 CATGCAAAACCATGTTAAGTTGG + Intergenic
1179592641 21:42419700-42419722 TAAGCCAAACCATTGTAAGTTGG - Intronic
1183852816 22:40605730-40605752 CAATTTAAAAGATTTTAGGTTGG - Intronic
952624253 3:35384486-35384508 CAAGCTAAACTCTGTGAGGTCGG - Intergenic
952826236 3:37527306-37527328 TAAGTTAAACCATTATAAGTCGG + Intronic
953271352 3:41448262-41448284 CACGCTAAACCAGTTTTCGTGGG + Intronic
953508817 3:43514176-43514198 CAAGCTCAACCTTTTTAATTGGG - Intronic
955173935 3:56593870-56593892 CAAGCTAAATCATTTTTGTTTGG - Intronic
955700914 3:61681154-61681176 CAAGCTAAAAGCTTTTAGGATGG - Intronic
955852684 3:63238037-63238059 CAAGATAAAGCATCTCAGGTTGG - Intronic
959775995 3:110163614-110163636 CAAGCTCAAGGAATTTAGGTTGG - Intergenic
960206479 3:114906748-114906770 CAGGATAATACATTTTAGGTAGG + Intronic
961032651 3:123619994-123620016 TAAGCTTAACCATTTTCGGAGGG - Intronic
964100223 3:152980096-152980118 AGAGCCAAACCATATTAGGTGGG - Intergenic
964123637 3:153212649-153212671 AGAGCTAATCCATTTTTGGTTGG - Intergenic
965240544 3:166191426-166191448 CAAGATGAGCCATTTGAGGTTGG + Intergenic
968865924 4:3211198-3211220 TAAGATAAACAATTTTAGGCCGG - Intronic
973039736 4:45455540-45455562 CAATCTAAGTCATTATAGGTAGG - Intergenic
975875919 4:78836754-78836776 CTAGCTAAAACATTATAGGTTGG + Intronic
976284398 4:83357075-83357097 CAAGCTAAACTAATTTATGATGG - Intergenic
980871138 4:138612520-138612542 CCAGCTCAAGCAGTTTAGGTAGG + Intergenic
980873455 4:138636359-138636381 AAAGCAAAACCATTTTATTTAGG + Intergenic
981623426 4:146729953-146729975 AAAGCCAAACCATATTAGGTGGG + Intronic
987251533 5:16106087-16106109 CAAGCTAAAACAATTTAGAATGG + Intronic
989441403 5:41476152-41476174 TAAGCTGAACCATTGTAAGTTGG + Intronic
990122546 5:52472837-52472859 CACATTCAACCATTTTAGGTAGG - Intergenic
990769352 5:59224980-59225002 CAAGTAAAACAATTTTTGGTTGG - Intronic
991228954 5:64307876-64307898 CAAGTCAAACCATTATAAGTTGG + Intronic
991398509 5:66229392-66229414 TAAGCCAAACCATCTGAGGTCGG - Intergenic
991457782 5:66822912-66822934 CAAGCCAAACCATATCAGCTGGG - Intronic
991712449 5:69421244-69421266 CAACCAAAATAATTTTAGGTAGG - Intronic
992207525 5:74445379-74445401 TAAGCTAAACCAGTTTAGTATGG - Intergenic
996340511 5:122433769-122433791 TAAGTTGAACCATTTTAAGTTGG - Intronic
1000390955 5:160722799-160722821 CAAGCCAAACCATCTTGGGATGG + Intronic
1001661859 5:173399491-173399513 TATGCAAGACCATTTTAGGTGGG - Intergenic
1003044592 6:2721663-2721685 GAGGCAAAACCACTTTAGGTTGG - Intronic
1004198124 6:13524071-13524093 AAAACTAAACCATTCTAGGAAGG + Intergenic
1004293237 6:14387353-14387375 CAATCTAAACTAATTTCGGTTGG + Intergenic
1013897661 6:115110157-115110179 CAAGATGAACTATTTTATGTGGG + Intergenic
1016634751 6:146275270-146275292 TAAGCTAGACCTTTTAAGGTGGG + Intronic
1017207762 6:151822250-151822272 GAAGCAAAACAATTTGAGGTAGG + Intronic
1020204951 7:6107003-6107025 GAAGCTAAACAATGTTATGTAGG - Intronic
1021630685 7:22643243-22643265 CAAACTAAACAATTTTAGTTTGG - Intergenic
1024205636 7:47157870-47157892 CAACCTATAGGATTTTAGGTTGG + Intergenic
1028035540 7:85976968-85976990 CAAGCAACACCATTTTGGTTTGG + Intergenic
1030911748 7:115258696-115258718 TAAGTTCAACCATTGTAGGTAGG - Intergenic
1031160835 7:118165879-118165901 TAAGTTGAACCATTTTAAGTTGG + Intergenic
1031368861 7:120938783-120938805 CAAGAGAAACAAGTTTAGGTTGG - Intergenic
1032293111 7:130608024-130608046 CAAGCTACACCATTATTGGAAGG + Intronic
1039037852 8:33378892-33378914 AAAGCCAAACCATATTAGGGAGG - Intronic
1040416091 8:47197362-47197384 AAATCTAAGACATTTTAGGTGGG - Intergenic
1040740544 8:50569863-50569885 CACACTAACCCATTTTTGGTTGG - Intronic
1043802925 8:84633867-84633889 CAAGCCAAACAATTATAAGTAGG - Intronic
1044236768 8:89840089-89840111 CAAGTTGAACCATCTTAAGTAGG - Intergenic
1044558009 8:93585799-93585821 CAAGCTGAACCTTTATAGGATGG + Intergenic
1045758755 8:105576886-105576908 CAAAATAAACCATTATAGGAAGG - Intronic
1049934394 9:487184-487206 TAAGCCAAACCATTGTAAGTTGG - Intronic
1050242449 9:3651410-3651432 AGAGCCAAACCATTTCAGGTAGG - Intergenic
1050679141 9:8089791-8089813 AAAGCTAAACCATATCAGGTTGG - Intergenic
1052096589 9:24391335-24391357 CAAGCTCAAGCATCCTAGGTTGG + Intergenic
1057239626 9:93397302-93397324 CAAGCTACAGAATTCTAGGTTGG + Intergenic
1186395788 X:9207484-9207506 GAACCTAAACCATTTTTGGAAGG - Intergenic
1186813598 X:13213939-13213961 CAAGATAAATGATTTGAGGTGGG + Intergenic
1187513848 X:19947490-19947512 TAAGTTAAACCATTGTAAGTTGG - Intronic
1190539093 X:51458789-51458811 CAGGCTAGAGCATTTTAGGAAGG + Intergenic
1190704539 X:53015926-53015948 TAAGTTGAACCATTTTAAGTCGG + Intergenic
1192173160 X:68869237-68869259 CAAGGTAAATAATTTTAGCTAGG - Intergenic
1194300445 X:92180572-92180594 ACAGCCAAACCATATTAGGTGGG - Intronic
1197011963 X:121575162-121575184 CAAGCTAGAACATTTGAGATAGG + Intergenic
1198227318 X:134657335-134657357 CAAGCCAAACCATTGCAAGTTGG + Intronic
1198642343 X:138770336-138770358 CAAGATAACTCATTTTAGCTGGG - Intronic