ID: 1097300642 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:58015037-58015059 |
| Sequence | TCTACAAAAATAAAAAGGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1097300642_1097300648 | 21 | Left | 1097300642 | 12:58015037-58015059 | CCACACCTTTTTATTTTTGTAGA | No data | ||
| Right | 1097300648 | 12:58015081-58015103 | CCCAGCTGGTCCCCAATTCCTGG | No data | ||||
| 1097300642_1097300645 | 7 | Left | 1097300642 | 12:58015037-58015059 | CCACACCTTTTTATTTTTGTAGA | No data | ||
| Right | 1097300645 | 12:58015067-58015089 | TCTTGCTATGTTGCCCCAGCTGG | 0: 28 1: 560 2: 7899 3: 43453 4: 110124 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1097300642 | Original CRISPR | TCTACAAAAATAAAAAGGTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||