ID: 1097300643

View in Genome Browser
Species Human (GRCh38)
Location 12:58015042-58015064
Sequence CTAGCTCTACAAAAATAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097300643_1097300648 16 Left 1097300643 12:58015042-58015064 CCTTTTTATTTTTGTAGAGCTAG No data
Right 1097300648 12:58015081-58015103 CCCAGCTGGTCCCCAATTCCTGG No data
1097300643_1097300645 2 Left 1097300643 12:58015042-58015064 CCTTTTTATTTTTGTAGAGCTAG No data
Right 1097300645 12:58015067-58015089 TCTTGCTATGTTGCCCCAGCTGG 0: 28
1: 560
2: 7899
3: 43453
4: 110124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097300643 Original CRISPR CTAGCTCTACAAAAATAAAA AGG (reversed) Intergenic
No off target data available for this crispr