ID: 1097300648

View in Genome Browser
Species Human (GRCh38)
Location 12:58015081-58015103
Sequence CCCAGCTGGTCCCCAATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097300641_1097300648 24 Left 1097300641 12:58015034-58015056 CCACCACACCTTTTTATTTTTGT No data
Right 1097300648 12:58015081-58015103 CCCAGCTGGTCCCCAATTCCTGG No data
1097300642_1097300648 21 Left 1097300642 12:58015037-58015059 CCACACCTTTTTATTTTTGTAGA No data
Right 1097300648 12:58015081-58015103 CCCAGCTGGTCCCCAATTCCTGG No data
1097300643_1097300648 16 Left 1097300643 12:58015042-58015064 CCTTTTTATTTTTGTAGAGCTAG No data
Right 1097300648 12:58015081-58015103 CCCAGCTGGTCCCCAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097300648 Original CRISPR CCCAGCTGGTCCCCAATTCC TGG Intergenic
No off target data available for this crispr