ID: 1097305778

View in Genome Browser
Species Human (GRCh38)
Location 12:58067526-58067548
Sequence AGTTGTACTCTGCTGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097305778_1097305784 11 Left 1097305778 12:58067526-58067548 CCTGCCAACAGCAGAGTACAACT No data
Right 1097305784 12:58067560-58067582 ACATGGTACCATTCCCCAGCAGG No data
1097305778_1097305780 -6 Left 1097305778 12:58067526-58067548 CCTGCCAACAGCAGAGTACAACT No data
Right 1097305780 12:58067543-58067565 ACAACTTTGAGCCCCTGACATGG No data
1097305778_1097305789 27 Left 1097305778 12:58067526-58067548 CCTGCCAACAGCAGAGTACAACT No data
Right 1097305789 12:58067576-58067598 CAGCAGGCTGAAATACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097305778 Original CRISPR AGTTGTACTCTGCTGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr