ID: 1097307332

View in Genome Browser
Species Human (GRCh38)
Location 12:58083977-58083999
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097307326_1097307332 29 Left 1097307326 12:58083925-58083947 CCATGTGCTTGTATGTCTGTGTG No data
Right 1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097307332 Original CRISPR GATGCAGGTTGGCCACATGA GGG Intergenic
No off target data available for this crispr