ID: 1097309707

View in Genome Browser
Species Human (GRCh38)
Location 12:58105213-58105235
Sequence TCCTTCCGCTATCAAAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097309707_1097309709 5 Left 1097309707 12:58105213-58105235 CCACTGCTTTGATAGCGGAAGGA No data
Right 1097309709 12:58105241-58105263 ACTGTGTGAATTCAGAGCGAGGG No data
1097309707_1097309710 27 Left 1097309707 12:58105213-58105235 CCACTGCTTTGATAGCGGAAGGA No data
Right 1097309710 12:58105263-58105285 GAAGCTAATCCATTTTAGAGTGG No data
1097309707_1097309708 4 Left 1097309707 12:58105213-58105235 CCACTGCTTTGATAGCGGAAGGA No data
Right 1097309708 12:58105240-58105262 TACTGTGTGAATTCAGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097309707 Original CRISPR TCCTTCCGCTATCAAAGCAG TGG (reversed) Intergenic
No off target data available for this crispr