ID: 1097309710

View in Genome Browser
Species Human (GRCh38)
Location 12:58105263-58105285
Sequence GAAGCTAATCCATTTTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097309707_1097309710 27 Left 1097309707 12:58105213-58105235 CCACTGCTTTGATAGCGGAAGGA No data
Right 1097309710 12:58105263-58105285 GAAGCTAATCCATTTTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097309710 Original CRISPR GAAGCTAATCCATTTTAGAG TGG Intergenic
No off target data available for this crispr