ID: 1097312790

View in Genome Browser
Species Human (GRCh38)
Location 12:58139495-58139517
Sequence TAGGGTATACACCTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097312790_1097312800 19 Left 1097312790 12:58139495-58139517 CCTTCCTCCAGGTGTATACCCTA No data
Right 1097312800 12:58139537-58139559 GTCCAACAAAGACAGAGAGTGGG No data
1097312790_1097312799 18 Left 1097312790 12:58139495-58139517 CCTTCCTCCAGGTGTATACCCTA No data
Right 1097312799 12:58139536-58139558 TGTCCAACAAAGACAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097312790 Original CRISPR TAGGGTATACACCTGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr