ID: 1097313226

View in Genome Browser
Species Human (GRCh38)
Location 12:58144049-58144071
Sequence CAGTGTGTATGAGAGACATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097313226_1097313230 11 Left 1097313226 12:58144049-58144071 CCGAATGTCTCTCATACACACTG No data
Right 1097313230 12:58144083-58144105 AGTCTTCAGGTCTATTGATTTGG No data
1097313226_1097313228 -2 Left 1097313226 12:58144049-58144071 CCGAATGTCTCTCATACACACTG No data
Right 1097313228 12:58144070-58144092 TGTCCATGGCATCAGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097313226 Original CRISPR CAGTGTGTATGAGAGACATT CGG (reversed) Intergenic
No off target data available for this crispr