ID: 1097313228

View in Genome Browser
Species Human (GRCh38)
Location 12:58144070-58144092
Sequence TGTCCATGGCATCAGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097313225_1097313228 10 Left 1097313225 12:58144037-58144059 CCTGGGTCATTTCCGAATGTCTC No data
Right 1097313228 12:58144070-58144092 TGTCCATGGCATCAGTCTTCAGG No data
1097313226_1097313228 -2 Left 1097313226 12:58144049-58144071 CCGAATGTCTCTCATACACACTG No data
Right 1097313228 12:58144070-58144092 TGTCCATGGCATCAGTCTTCAGG No data
1097313224_1097313228 25 Left 1097313224 12:58144022-58144044 CCTGAGATGTGACAACCTGGGTC No data
Right 1097313228 12:58144070-58144092 TGTCCATGGCATCAGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097313228 Original CRISPR TGTCCATGGCATCAGTCTTC AGG Intergenic
No off target data available for this crispr