ID: 1097316065

View in Genome Browser
Species Human (GRCh38)
Location 12:58172768-58172790
Sequence AGCAGGGCGTCTAAATGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097316065_1097316072 12 Left 1097316065 12:58172768-58172790 CCCTAACATTTAGACGCCCTGCT No data
Right 1097316072 12:58172803-58172825 GGTCATGAATGCTTCTGAGGAGG No data
1097316065_1097316073 19 Left 1097316065 12:58172768-58172790 CCCTAACATTTAGACGCCCTGCT No data
Right 1097316073 12:58172810-58172832 AATGCTTCTGAGGAGGTCTCAGG No data
1097316065_1097316067 -9 Left 1097316065 12:58172768-58172790 CCCTAACATTTAGACGCCCTGCT No data
Right 1097316067 12:58172782-58172804 CGCCCTGCTGTCTCCTAGTCTGG No data
1097316065_1097316071 9 Left 1097316065 12:58172768-58172790 CCCTAACATTTAGACGCCCTGCT No data
Right 1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097316065 Original CRISPR AGCAGGGCGTCTAAATGTTA GGG (reversed) Intergenic
No off target data available for this crispr