ID: 1097316069

View in Genome Browser
Species Human (GRCh38)
Location 12:58172785-58172807
Sequence TGACCAGACTAGGAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097316069_1097316074 20 Left 1097316069 12:58172785-58172807 CCTGCTGTCTCCTAGTCTGGTCA No data
Right 1097316074 12:58172828-58172850 TCAGGACGCTTGACGTCATCAGG No data
1097316069_1097316071 -8 Left 1097316069 12:58172785-58172807 CCTGCTGTCTCCTAGTCTGGTCA No data
Right 1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG No data
1097316069_1097316072 -5 Left 1097316069 12:58172785-58172807 CCTGCTGTCTCCTAGTCTGGTCA No data
Right 1097316072 12:58172803-58172825 GGTCATGAATGCTTCTGAGGAGG No data
1097316069_1097316073 2 Left 1097316069 12:58172785-58172807 CCTGCTGTCTCCTAGTCTGGTCA No data
Right 1097316073 12:58172810-58172832 AATGCTTCTGAGGAGGTCTCAGG No data
1097316069_1097316075 23 Left 1097316069 12:58172785-58172807 CCTGCTGTCTCCTAGTCTGGTCA No data
Right 1097316075 12:58172831-58172853 GGACGCTTGACGTCATCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097316069 Original CRISPR TGACCAGACTAGGAGACAGC AGG (reversed) Intergenic
No off target data available for this crispr