ID: 1097316071

View in Genome Browser
Species Human (GRCh38)
Location 12:58172800-58172822
Sequence TCTGGTCATGAATGCTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097316065_1097316071 9 Left 1097316065 12:58172768-58172790 CCCTAACATTTAGACGCCCTGCT No data
Right 1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG No data
1097316066_1097316071 8 Left 1097316066 12:58172769-58172791 CCTAACATTTAGACGCCCTGCTG No data
Right 1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG No data
1097316069_1097316071 -8 Left 1097316069 12:58172785-58172807 CCTGCTGTCTCCTAGTCTGGTCA No data
Right 1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG No data
1097316068_1097316071 -7 Left 1097316068 12:58172784-58172806 CCCTGCTGTCTCCTAGTCTGGTC No data
Right 1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097316071 Original CRISPR TCTGGTCATGAATGCTTCTG AGG Intergenic
No off target data available for this crispr