ID: 1097318792

View in Genome Browser
Species Human (GRCh38)
Location 12:58202629-58202651
Sequence TTGAACAAAAAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097318792_1097318800 23 Left 1097318792 12:58202629-58202651 CCTTCCTCCATCTTTTTGTTCAA No data
Right 1097318800 12:58202675-58202697 GATACCCGACCACACTGGAGAGG No data
1097318792_1097318796 -2 Left 1097318792 12:58202629-58202651 CCTTCCTCCATCTTTTTGTTCAA No data
Right 1097318796 12:58202650-58202672 AATTCAGGCCCTCAATGAATTGG No data
1097318792_1097318799 18 Left 1097318792 12:58202629-58202651 CCTTCCTCCATCTTTTTGTTCAA No data
Right 1097318799 12:58202670-58202692 TGGATGATACCCGACCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097318792 Original CRISPR TTGAACAAAAAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr