ID: 1097321824

View in Genome Browser
Species Human (GRCh38)
Location 12:58234070-58234092
Sequence GTATATCAACAGGTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097321824_1097321832 6 Left 1097321824 12:58234070-58234092 CCCACCTCCACCTGTTGATATAC No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321824_1097321833 7 Left 1097321824 12:58234070-58234092 CCCACCTCCACCTGTTGATATAC No data
Right 1097321833 12:58234100-58234122 CTGTTGATATACTCACCATGGGG No data
1097321824_1097321830 5 Left 1097321824 12:58234070-58234092 CCCACCTCCACCTGTTGATATAC No data
Right 1097321830 12:58234098-58234120 ACCTGTTGATATACTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097321824 Original CRISPR GTATATCAACAGGTGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr