ID: 1097321832

View in Genome Browser
Species Human (GRCh38)
Location 12:58234099-58234121
Sequence CCTGTTGATATACTCACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097321821_1097321832 28 Left 1097321821 12:58234048-58234070 CCTTTTCTTCCTTTGCTGGGGCC No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321826_1097321832 2 Left 1097321826 12:58234074-58234096 CCTCCACCTGTTGATATACTCAC No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321824_1097321832 6 Left 1097321824 12:58234070-58234092 CCCACCTCCACCTGTTGATATAC No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321823_1097321832 7 Left 1097321823 12:58234069-58234091 CCCCACCTCCACCTGTTGATATA No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321820_1097321832 29 Left 1097321820 12:58234047-58234069 CCCTTTTCTTCCTTTGCTGGGGC No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321825_1097321832 5 Left 1097321825 12:58234071-58234093 CCACCTCCACCTGTTGATATACT No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321828_1097321832 -4 Left 1097321828 12:58234080-58234102 CCTGTTGATATACTCACCACCTG No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321827_1097321832 -1 Left 1097321827 12:58234077-58234099 CCACCTGTTGATATACTCACCAC No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data
1097321822_1097321832 19 Left 1097321822 12:58234057-58234079 CCTTTGCTGGGGCCCCACCTCCA No data
Right 1097321832 12:58234099-58234121 CCTGTTGATATACTCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097321832 Original CRISPR CCTGTTGATATACTCACCAT GGG Intergenic
No off target data available for this crispr