ID: 1097329891

View in Genome Browser
Species Human (GRCh38)
Location 12:58321438-58321460
Sequence CCTCATAATTGACTAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097329886_1097329891 20 Left 1097329886 12:58321395-58321417 CCATTGAAAGTAATGGCAAAAAC 0: 153
1: 381
2: 617
3: 587
4: 761
Right 1097329891 12:58321438-58321460 CCTCATAATTGACTAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097329891 Original CRISPR CCTCATAATTGACTAGGAAT GGG Intergenic
No off target data available for this crispr