ID: 1097331292

View in Genome Browser
Species Human (GRCh38)
Location 12:58335171-58335193
Sequence ATTGATAAGCTACTGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097331286_1097331292 6 Left 1097331286 12:58335142-58335164 CCGATACTGAAGTTCAGCCGGCG 0: 11
1: 9
2: 9
3: 9
4: 33
Right 1097331292 12:58335171-58335193 ATTGATAAGCTACTGGTGGTTGG No data
1097331283_1097331292 29 Left 1097331283 12:58335119-58335141 CCATACTGACTTTCTGGGGGTGG 0: 23
1: 6
2: 5
3: 9
4: 147
Right 1097331292 12:58335171-58335193 ATTGATAAGCTACTGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097331292 Original CRISPR ATTGATAAGCTACTGGTGGT TGG Intergenic
No off target data available for this crispr