ID: 1097333297

View in Genome Browser
Species Human (GRCh38)
Location 12:58355589-58355611
Sequence GGGAATGAGTATATGGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097333294_1097333297 -8 Left 1097333294 12:58355574-58355596 CCTGAAGCAGCCTTTGGGAATGA No data
Right 1097333297 12:58355589-58355611 GGGAATGAGTATATGGCTATAGG No data
1097333293_1097333297 -7 Left 1097333293 12:58355573-58355595 CCCTGAAGCAGCCTTTGGGAATG No data
Right 1097333297 12:58355589-58355611 GGGAATGAGTATATGGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097333297 Original CRISPR GGGAATGAGTATATGGCTAT AGG Intergenic
No off target data available for this crispr