ID: 1097343588

View in Genome Browser
Species Human (GRCh38)
Location 12:58466977-58466999
Sequence TGTGCACCTGGAAAAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1504
Summary {0: 45, 1: 94, 2: 244, 3: 392, 4: 729}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097343588_1097343593 2 Left 1097343588 12:58466977-58466999 CCTGTGGCTTTTCCAGGTGCACA 0: 45
1: 94
2: 244
3: 392
4: 729
Right 1097343593 12:58467002-58467024 GCAAACTGCTTGTAGGGGTCTGG No data
1097343588_1097343594 5 Left 1097343588 12:58466977-58466999 CCTGTGGCTTTTCCAGGTGCACA 0: 45
1: 94
2: 244
3: 392
4: 729
Right 1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG No data
1097343588_1097343596 12 Left 1097343588 12:58466977-58466999 CCTGTGGCTTTTCCAGGTGCACA 0: 45
1: 94
2: 244
3: 392
4: 729
Right 1097343596 12:58467012-58467034 TGTAGGGGTCTGGAGGATGGTGG No data
1097343588_1097343595 9 Left 1097343588 12:58466977-58466999 CCTGTGGCTTTTCCAGGTGCACA 0: 45
1: 94
2: 244
3: 392
4: 729
Right 1097343595 12:58467009-58467031 GCTTGTAGGGGTCTGGAGGATGG No data
1097343588_1097343590 -5 Left 1097343588 12:58466977-58466999 CCTGTGGCTTTTCCAGGTGCACA 0: 45
1: 94
2: 244
3: 392
4: 729
Right 1097343590 12:58466995-58467017 GCACAGTGCAAACTGCTTGTAGG No data
1097343588_1097343591 -4 Left 1097343588 12:58466977-58466999 CCTGTGGCTTTTCCAGGTGCACA 0: 45
1: 94
2: 244
3: 392
4: 729
Right 1097343591 12:58466996-58467018 CACAGTGCAAACTGCTTGTAGGG No data
1097343588_1097343592 -3 Left 1097343588 12:58466977-58466999 CCTGTGGCTTTTCCAGGTGCACA 0: 45
1: 94
2: 244
3: 392
4: 729
Right 1097343592 12:58466997-58467019 ACAGTGCAAACTGCTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097343588 Original CRISPR TGTGCACCTGGAAAAGCCAC AGG (reversed) Intergenic
900397379 1:2458620-2458642 TGTGCCCCTGGAGCAGCCAGTGG + Intronic
900495481 1:2974150-2974172 CGTCCACCTGGAGAAGGCACAGG - Intergenic
900628594 1:3621723-3621745 CCTGCACCTGGAAAAGCCGTAGG + Intergenic
900740266 1:4326854-4326876 TGTGCACACGGAAATGGCACGGG + Intergenic
901797453 1:11688660-11688682 TGTGAGCCTGCAAAGGCCACAGG - Intronic
901956210 1:12787599-12787621 AGAGCACATGGAAAAGACACAGG + Intergenic
901979590 1:13023668-13023690 AGAGCACATGGAAAAGACACAGG + Intronic
902002493 1:13205270-13205292 AGAGCACATGGAAAAGACACAGG - Intergenic
902021727 1:13351034-13351056 AGAGCACATGGAAAAGACACAGG - Intergenic
902085378 1:13856192-13856214 TGTGCACCTGAAAAAGCTGCAGG + Intergenic
902540747 1:17152741-17152763 TTTGTACCTAGAAAAGCCGCAGG + Intergenic
903674487 1:25055498-25055520 TGTGCAGCTTTAAAAGCCAGTGG + Intergenic
904375167 1:30076529-30076551 CATGCACCTGAAAAAGCCACAGG + Intergenic
905808426 1:40893930-40893952 CATGCACCTGAAAAAGCCTCAGG - Intergenic
906083373 1:43108625-43108647 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
906125218 1:43423278-43423300 TGTGGTCCTGCATAAGCCACTGG + Exonic
906183469 1:43841162-43841184 CCTGCACCTGAAAAAGCCTCAGG - Intronic
906353687 1:45084839-45084861 TGTGCACCTGGAAAAGCCACAGG - Intronic
906664293 1:47608255-47608277 TGTACACCTGAAAAAGCCACAGG - Intergenic
906693799 1:47810785-47810807 TCTGGACCTGGCACAGCCACAGG + Intronic
906850090 1:49238816-49238838 TGGCAACCTGGAAATGCCACAGG - Intronic
906872889 1:49503506-49503528 TGTGCACCTGGAAAAGCCACAGG + Intronic
906938503 1:50235331-50235353 CATGCACCTGGGAAAGCTACAGG + Intergenic
907259454 1:53206436-53206458 CATGTGCCTGGAAAAGCCACAGG + Intronic
907687216 1:56623698-56623720 TATGCGCCTGGAAAAGCCACGGG + Intronic
907749285 1:57246671-57246693 TGTGTACCTGGAAAAGCCACAGG + Intronic
907808077 1:57841311-57841333 TATGCATATGGAAAAGCCACAGG - Intronic
907937736 1:59057666-59057688 TTTGCACCTGGCTAACCCACAGG + Intergenic
908032903 1:60020370-60020392 CGTGTGCTTGGAAAAGCCACAGG + Intronic
908094415 1:60721793-60721815 CATGCACTTGGAAAAGCCACAGG + Intergenic
908407702 1:63831148-63831170 TGTGCACCTGGAAAAGGTGCAGG - Intronic
908616716 1:65930429-65930451 CCTGCACCTGGAAAAGCTACAGG + Intronic
908715786 1:67068021-67068043 TGGACACCTGGAAAAGCCACAGG + Intergenic
908879085 1:68710399-68710421 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
908932246 1:69331326-69331348 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
908963476 1:69729688-69729710 CATGTGCCTGGAAAAGCCACAGG - Intronic
909024103 1:70463278-70463300 CATGCACCTGGAAAAGCTGCAGG + Intergenic
909104793 1:71394076-71394098 CCTACACCTGTAAAAGCCACAGG + Intergenic
909235890 1:73152464-73152486 CATGCACCTGGAAAAGCTGCAGG - Intergenic
909269140 1:73600744-73600766 GGTGCATCTGGGAAAGCCACTGG - Intergenic
909364039 1:74798964-74798986 CCTGCACCTGGAAAAGCCACAGG - Intergenic
909369779 1:74870414-74870436 CCTGCACCTGGAAAAGCTTCAGG + Intergenic
909422713 1:75484550-75484572 TGTGCACCTGGAAAAGCCACAGG - Intronic
909503625 1:76362862-76362884 CCTGCACCTGGAAAAGCTGCAGG - Intronic
909532041 1:76692539-76692561 CCTGCACCTGGAAAAGCCACAGG - Intergenic
909691349 1:78410530-78410552 TGTGGATCTGGACAAGCCCCTGG - Intronic
909751409 1:79165837-79165859 TGTGTGCCTGGAAAAGCCGCAGG + Intergenic
909774239 1:79464342-79464364 CATGTGCCTGGAAAAGCCACAGG - Intergenic
909866986 1:80686093-80686115 TGTGCACCTGGAAAAGCTGGAGG - Intergenic
910013750 1:82496250-82496272 TGTGCACCTGGAAAAGCCACAGG - Intergenic
910141453 1:84031447-84031469 GGTGTACCTTGCAAAGCCACAGG - Intergenic
910141461 1:84031507-84031529 AGTGCACCAGGAAAAGCCACAGG - Intergenic
910327572 1:86027808-86027830 CATTCACCTGGAAAAGCCACAGG + Intronic
910563508 1:88618321-88618343 TATGCACCTGGAAAAGCTGCAGG - Intergenic
910706862 1:90139575-90139597 CATGCACTTGGAAAAGCCTCAGG - Intergenic
911009322 1:93262667-93262689 CGTGCACTTGGAAAAGCCCCAGG - Intronic
911009474 1:93263901-93263923 CCTTCACCTGGAAAAGCCTCAGG - Intronic
911023178 1:93408836-93408858 TGTGTGCCTGGAAAAGCCCCAGG + Intergenic
911082763 1:93949873-93949895 CATGTACCTGGAAAAGCCTCAGG - Intergenic
911179691 1:94849417-94849439 TGTGCACCTGGGTCGGCCACAGG - Intronic
911235167 1:95404467-95404489 TGTGCACCTGGAAAAGCCACAGG + Intergenic
911465882 1:98251758-98251780 TGTGTACCTGGAAAAGCCGCAGG + Intergenic
911584946 1:99679835-99679857 TGGGCACCTAGAAAGGCAACCGG - Intronic
911780401 1:101869185-101869207 TGTGCACCTGGGAAAACTGCAGG + Intronic
911788343 1:101979823-101979845 TGTGCACCTGGAAAAGCTGCAGG + Intronic
911829876 1:102536977-102536999 TATGCACCTGGAAAAGCCACAGG - Intergenic
912006155 1:104903770-104903792 TGTGCACCTGGAAAAGCCATAGG - Intergenic
912055906 1:105597598-105597620 TGTGCACCTGGAAAATCCTCAGG + Intergenic
912068702 1:105779889-105779911 CATGTACCTGGAAAAGCCACAGG + Intergenic
912074114 1:105850683-105850705 TCTGCACCTAGAAAAGCTGCAGG + Intergenic
912113437 1:106372599-106372621 CGTGTACTTGGAAAAGCCACAGG - Intergenic
912136229 1:106662891-106662913 TGTGCACCTAGAAAAGCCACTGG + Intergenic
912206105 1:107510975-107510997 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
912267650 1:108174700-108174722 TCTGTACCCTGAAAAGCCACAGG + Intronic
912735977 1:112149811-112149833 CATGCACCTGGAAAAGCCATGGG + Intergenic
912809429 1:112782794-112782816 CCTGCACCTGGAAAAACCACAGG - Intergenic
913039983 1:115012596-115012618 TTTGTGCCTGGAAAAGCTACAGG + Intergenic
913244653 1:116860925-116860947 TGTGCCTCTGGAGAAGCCTCTGG - Intergenic
913396520 1:118377834-118377856 TGTGCACCTGGATAAGCCAAAGG + Intergenic
913402265 1:118449167-118449189 TGTGCACCTGTAAAAGCCGCAGG + Intergenic
913445948 1:118950946-118950968 TGTGCACTCCGAAAAGACACTGG + Intronic
913509372 1:119548157-119548179 TGGTCACTGGGAAAAGCCACAGG + Intergenic
914406819 1:147383237-147383259 TGTGCATCTGTAAATTCCACAGG + Intergenic
914857446 1:151362964-151362986 CCTGCACCTGGAAAAGCCACAGG + Intergenic
914954384 1:152147780-152147802 TCTGAGCCTGGAAAAGCCACAGG - Intergenic
914988042 1:152476460-152476482 TGTGCACCTGGAAAAGCCACAGG - Intergenic
915058393 1:153158540-153158562 CGTGCACCTAGAAAAGCTGCAGG - Intergenic
915341681 1:155179906-155179928 TGTGCACCTGCACACGCCCCCGG + Exonic
915855675 1:159383920-159383942 CCTTCACCTGGAAAAGCCACAGG + Intergenic
916035906 1:160922286-160922308 CATCCACCTGGAAAAGCCAAAGG + Intergenic
916296716 1:163228043-163228065 TGTGCACCTAGAAAAGCTGCAGG - Intronic
916302743 1:163294052-163294074 TGTACACCTGAAAAAGCCACAGG - Intronic
916384874 1:164255889-164255911 CATGCACCTGGAAAAGCCAGAGG + Intergenic
916790363 1:168120105-168120127 CATGCACCTGGAAAAGCCGCAGG + Intronic
917002439 1:170374812-170374834 CCAGCACCTGGAAAAGCCACAGG - Intergenic
917051681 1:170931855-170931877 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
917205215 1:172564311-172564333 CGTGCACCTGGAAAAGTAGCAGG + Intronic
918323023 1:183382856-183382878 CGTGCACTTGGAAAAGCTGCAGG - Intronic
918485810 1:185027251-185027273 CGTGCACCTCGAAAAGCCACAGG - Intergenic
918734242 1:188038191-188038213 TGAGCACTTGGAAAAGCCACAGG + Intergenic
918752423 1:188289711-188289733 CATGTGCCTGGAAAAGCCACAGG - Intergenic
918956676 1:191217378-191217400 TGTGTTCCTGGAAAAGCCACAGG - Intergenic
919044257 1:192431027-192431049 CATGCCCCTGGAAAAGCCACAGG + Intergenic
919388681 1:196954409-196954431 TATGCACCTGGAAAGGCTGCAGG - Intronic
919521953 1:198600002-198600024 TGTGTGCCTGAAAAAGCCACAGG + Intergenic
920594488 1:207255364-207255386 TATGTGCCTGGAAAAGCCACAGG - Intergenic
920674833 1:208031589-208031611 GGCACACCTGGAAAAGCAACTGG - Exonic
920785263 1:209034906-209034928 TCTGCACCTGGAAAAGCTGTAGG - Intergenic
921013789 1:211168810-211168832 CATGCACCTGGAAAAGCTGCAGG - Intergenic
921465046 1:215477378-215477400 CATGCACCTAGAAAAGCCACAGG - Intergenic
921621391 1:217329903-217329925 CGTGCACCTGGAAAAGCCACAGG - Intergenic
921758292 1:218883718-218883740 TGTGCACATGGAAAAGTCATAGG - Intergenic
922229592 1:223674153-223674175 TGTGCACCTGGAAAAGCCACAGG - Intergenic
922370206 1:224902345-224902367 TCTGAAACTGGAAAAGTCACTGG + Intronic
923097186 1:230784885-230784907 CTTGAGCCTGGAAAAGCCACAGG + Intronic
923139777 1:231151511-231151533 CCTGCACCTGGAAAAGCTCCAGG - Intergenic
923890886 1:238214162-238214184 TGTGCACCTGGAAAAGCCACAGG - Intergenic
923941569 1:238832809-238832831 TGTGTGCCTGGAAAAGACACAGG + Intergenic
924152391 1:241142203-241142225 TGTGCACCTGGAAAACCTGTAGG - Intronic
924191469 1:241557176-241557198 CGTGTTCATGGAAAAGCCACTGG + Intronic
924638518 1:245811140-245811162 TGGGAAACTGGAAAGGCCACAGG - Intronic
924759191 1:246968461-246968483 TGTGTGCTTGGAAAAGCCACAGG - Intronic
924936656 1:248777620-248777642 CATGAACCTGGAAAAGCCACAGG + Intergenic
924953675 1:248907589-248907611 AATGCACCATGAAAAGCCACAGG - Intronic
1062770451 10:96251-96273 CGTGCACCTGGAAAAGCCACAGG - Intergenic
1063063931 10:2589806-2589828 TGTGCAGCTGGAAAAACAACAGG - Intergenic
1064362299 10:14677168-14677190 TGAGTTCCTGGAAAGGCCACTGG - Intronic
1064902656 10:20311769-20311791 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
1065125584 10:22570477-22570499 TGTGCCCCTGGAATTGCCCCTGG - Intronic
1065534271 10:26701839-26701861 CGTGCACCTGGAAAAGCTGCAGG + Intronic
1067573157 10:47386316-47386338 CTTGTGCCTGGAAAAGCCACAGG - Intergenic
1067716573 10:48695079-48695101 TGTCCTCCAGGCAAAGCCACTGG - Intronic
1068056178 10:52014994-52015016 TATGCACTTGGAAAAGCCACAGG - Intronic
1068215542 10:53978038-53978060 TGTGTGCCTGGAAAAGCTACAGG - Intronic
1068305300 10:55200134-55200156 TGTACACTTTGAAAAGACACAGG + Intronic
1068449299 10:57165386-57165408 TGTGCACCCTAAAAAGCCACAGG - Intergenic
1068495011 10:57776415-57776437 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1068604529 10:58990513-58990535 TATACACCTGGAAAAGCCACAGG + Intergenic
1069077318 10:64051983-64052005 CATGCACCTGGAAAAGTCATAGG - Intergenic
1069174970 10:65279530-65279552 TATGTGCCTGGAAAAGCCACAGG + Intergenic
1069532110 10:69227191-69227213 TGTCCACCTGGAACAGACACCGG - Exonic
1069534027 10:69240092-69240114 TTTTCTCCTGGAAATGCCACTGG + Intronic
1070224129 10:74482930-74482952 CATGCACCTGGAAAAGCTGCAGG - Intronic
1070490005 10:76967376-76967398 GGGGCAACTGGAAAAGCCACAGG + Intronic
1071245272 10:83754662-83754684 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1071331062 10:84561174-84561196 TGTAGTTCTGGAAAAGCCACTGG + Intergenic
1071826148 10:89328237-89328259 TGTACACCAAAAAAAGCCACAGG - Intronic
1071962802 10:90823193-90823215 CATGCACCTGGAAAAGCTGCAGG + Intronic
1071990102 10:91093161-91093183 TGTGCACCAGGAAAAACTACAGG - Intergenic
1072358284 10:94633593-94633615 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1072569732 10:96648114-96648136 TGTGCACCTGGAAAGGCATCAGG - Intronic
1073929298 10:108555721-108555743 CATGCACCTGGAAGAGCCACAGG + Intergenic
1073952664 10:108829094-108829116 CTTGCACCTGGAAAAGCCACAGG - Intergenic
1073964936 10:108978189-108978211 CATGCACCTGGAAAAGCCACAGG + Intergenic
1073979913 10:109142802-109142824 TGTGCCCCTAGAAAAGCCACAGG + Intergenic
1073990919 10:109261466-109261488 CATACACCTGGAAAAGCCTCAGG - Intergenic
1074226495 10:111489278-111489300 CTTGCACCTGGAAAAGCCACAGG + Intergenic
1075345538 10:121679473-121679495 TGTGCAGCTGAAGAAGCCAGTGG + Intergenic
1076086172 10:127634248-127634270 TGTGCATCTGGAAAAGCCACAGG - Intergenic
1076118213 10:127916031-127916053 TGTGGACCTGGAGCATCCACAGG - Intronic
1076155610 10:128202838-128202860 TGTGCACCTGGAAAAACCACAGG + Intergenic
1076259708 10:129055590-129055612 GGTGCTCCTGCAAAAACCACTGG + Intergenic
1076763776 10:132619464-132619486 CCTGTGCCTGGAAAAGCCACAGG - Intronic
1077581522 11:3420411-3420433 GGTGCACCTGGATGAGTCACAGG + Intergenic
1077736788 11:4800017-4800039 CCTGAGCCTGGAAAAGCCACAGG - Intronic
1077979518 11:7286001-7286023 CATGTGCCTGGAAAAGCCACAGG - Intronic
1077993377 11:7432083-7432105 CCTGTGCCTGGAAAAGCCACAGG + Intronic
1078393439 11:10956403-10956425 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1078747413 11:14128557-14128579 TGTGTACCTGGAAAAGCTATGGG - Intronic
1078826934 11:14938663-14938685 TGTGCAACTGGAAAATCTGCAGG - Intronic
1078978643 11:16506134-16506156 TGTGCACCTGGAAAAGCCACAGG + Intronic
1079465218 11:20723615-20723637 TGTGTGCTTGGAAAAGCCACAGG - Intronic
1079713725 11:23718398-23718420 TGTGCTCCTAGAAAAGCCACAGG + Intergenic
1079759472 11:24310631-24310653 CATATACCTGGAAAAGCCACAGG + Intergenic
1079772071 11:24474889-24474911 TCTGCACCTGGAAAAGCTGCAGG - Intergenic
1079804360 11:24910869-24910891 CGTGCACCTGGAAAAGGCATGGG + Intronic
1079903947 11:26222342-26222364 GCTGCACCCTGAAAAGCCACAGG - Intergenic
1079916235 11:26371548-26371570 CATGCACCTGGAAGAGCCGCAGG + Intronic
1079925772 11:26489554-26489576 CATGTGCCTGGAAAAGCCACGGG + Intronic
1079957376 11:26881927-26881949 TGTGCACCTGGAAATGCTGCAGG + Intergenic
1080843297 11:36004534-36004556 TATGCACCTGGAAAAGCCACAGG - Intronic
1080997300 11:37619353-37619375 TGTGAACCTGGAAAAGCTGAAGG + Intergenic
1081016678 11:37891171-37891193 TATGCTCCTTGAAAAGCCCCAGG - Intergenic
1081163987 11:39786067-39786089 TGGGCACCATGAACAGCCACAGG - Intergenic
1081246305 11:40770940-40770962 TGAGTGCCTAGAAAAGCCACAGG - Intronic
1081261918 11:40971700-40971722 CTTGCACCTGGTAAAGCCCCAGG + Intronic
1081316493 11:41637264-41637286 GTTGTACCTGGCAAAGCCACAGG - Intergenic
1081358571 11:42144438-42144460 TGTGCACTTGGAAAAGCCACAGG - Intergenic
1081441439 11:43085629-43085651 TGTGCACCTGGAAAACCCTCAGG - Intergenic
1081669910 11:44937121-44937143 TGTGCTCCTGGAGAAGGCACAGG + Intronic
1082080599 11:48009737-48009759 TGTGCCCCTGGGCAAGTCACTGG + Intronic
1082570061 11:54727739-54727761 CCTGCACCTAGAAAAGCCATGGG - Intergenic
1082692645 11:56324839-56324861 TATGAACCTGGAAAAGCTGCAGG + Intergenic
1082733089 11:56824429-56824451 ACTGCATCTGAAAAAGCCACAGG - Intergenic
1082827041 11:57587502-57587524 TGTGCACCTAGAAAAGCCACAGG + Intergenic
1083540716 11:63510008-63510030 TGTGCACCAGTAATAGCCAAGGG + Intronic
1084176147 11:67423359-67423381 GGTGCAGCTGCAGAAGCCACAGG - Exonic
1084238435 11:67803229-67803251 GGTGCACCTGGATGAGTCACAGG + Intergenic
1084308906 11:68304583-68304605 CCTGCACCTGGAAAAGCCGCAGG + Intergenic
1084362613 11:68678556-68678578 TGTGGTGCTGGAAAGGCCACAGG - Intergenic
1084400048 11:68938257-68938279 TGTGCACTTGGCAAAGCCGCAGG - Exonic
1084566600 11:69932154-69932176 TCTGCTGCTGGGAAAGCCACTGG - Intergenic
1084695251 11:70749270-70749292 TGTGCATCTGCAAAAGCCCCAGG + Intronic
1084833974 11:71789596-71789618 GGTGCACCTGGATGAGTCACAGG - Intronic
1085000381 11:73028170-73028192 CATGTACCTGGAAAAGCCGCAGG + Intronic
1085308273 11:75500665-75500687 TCTGCACCTGGACATCCCACAGG + Intronic
1085418434 11:76335383-76335405 CCTGTAGCTGGAAAAGCCACAGG + Intergenic
1085600818 11:77854689-77854711 CATGCACCTGGAAAACCCGCAGG - Intronic
1086436901 11:86790767-86790789 TGTGCTCCAGGAAAAGCCAGAGG + Intergenic
1086669323 11:89527937-89527959 TGTCCACCTGGAAAAGCTGCAGG + Intergenic
1086669769 11:89532225-89532247 TGTGCACCTGGAAAAACTGCAGG + Intergenic
1086729270 11:90227783-90227805 TCTGTACCTGGAAAATCCACAGG - Intergenic
1086799346 11:91152425-91152447 TGTGTTACTAGAAAAGCCACAGG - Intergenic
1087447039 11:98268606-98268628 TATGCACCTGGAAAAGCCACAGG - Intergenic
1087474276 11:98617784-98617806 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1087480449 11:98693514-98693536 TGTGCACCTGGAAAATCTGCAGG + Intergenic
1087497639 11:98910410-98910432 CAAGCACCTGGAAAAGCCACAGG + Intergenic
1087576913 11:100000536-100000558 TGAGCACCCAGAAAAGCCATAGG - Intronic
1087708443 11:101521642-101521664 TGTGAACCTGGAAAAGCCACAGG + Intronic
1087763715 11:102127736-102127758 CGTGCTCCTGGAAAAGCTGCAGG + Intronic
1087807249 11:102568625-102568647 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1087849183 11:103009229-103009251 TCTGCACCTGGAAATGTCACAGG - Intergenic
1088953804 11:114598302-114598324 TCTGCACCTGGAAAAACCAAAGG - Intergenic
1089820968 11:121225938-121225960 CCTGCACTGGGAAAAGCCACAGG - Intergenic
1090756304 11:129794826-129794848 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
1090842815 11:130507597-130507619 TGTGTGCCTGGAAAAGCTTCAGG + Intergenic
1091090580 11:132767585-132767607 TGAGCACCTGGGTAAGCCAGAGG - Intronic
1091316331 11:134616463-134616485 TCTGCTTCTGGAAAAGCCTCGGG - Intergenic
1091448148 12:556568-556590 TGTGAACGTGGAAAAGCGTCAGG + Exonic
1091552937 12:1550526-1550548 TGTGTGCCTGGAAAAGCTGCAGG + Intronic
1092409127 12:8240870-8240892 GGTGCACCTGGATGAGTCACAGG + Intergenic
1092670573 12:10856415-10856437 CATGCACCTGGAAAAGCTGCAGG + Intronic
1093123343 12:15299648-15299670 GCTGTACCTTGAAAAGCCACAGG - Intronic
1093570754 12:20663394-20663416 TGTGCACCTGGAAAAGCCACAGG + Intronic
1093591214 12:20904538-20904560 TGTGTGCCTGGAAAAGCTGCAGG - Intronic
1093596882 12:20972821-20972843 CATGCACCTGGAAAAGCCACAGG + Intergenic
1094295649 12:28901618-28901640 CATGTGCCTGGAAAAGCCACAGG + Intergenic
1094358738 12:29607093-29607115 TGTGCACATGGAAAAGCCACAGG + Intronic
1094379823 12:29830921-29830943 TATGAACCTGGAAAAGCCACAGG - Intergenic
1094815400 12:34178811-34178833 CTTGCACCTGGAAAAGCCAGAGG - Intergenic
1095101579 12:38190539-38190561 CTTGGACCTGGAAAAGCCAGAGG + Intergenic
1095226689 12:39686087-39686109 CTAGCTCCTGGAAAAGCCACAGG - Intronic
1095300786 12:40581677-40581699 CATGCACCTGGAAAAGCCACAGG - Intergenic
1095516895 12:43016008-43016030 TGTGTGCCTGGAAAAGCCACAGG + Intergenic
1095580164 12:43788382-43788404 TCTGAGCTTGGAAAAGCCACAGG + Intronic
1095639278 12:44468214-44468236 CCTGCACCTGGAACAGCCACAGG + Intergenic
1095728109 12:45474320-45474342 CCTGAGCCTGGAAAAGCCACAGG + Intergenic
1095731501 12:45511320-45511342 TGTGCACCTGGAAAACCAGAAGG - Intergenic
1095978739 12:47958027-47958049 TGTGCACCTGGAAAAGTAGTAGG + Intergenic
1097139326 12:56886692-56886714 TGTGCACCTGGAAAAGCTGTAGG + Intergenic
1097343588 12:58466977-58466999 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1097444020 12:59646703-59646725 TGTGCACCTGGAAAAGCTGCAGG + Intronic
1097445679 12:59668263-59668285 TGTGAACCTGGAAAAGCCACAGG + Intronic
1097476133 12:60058217-60058239 TGTGCACCTGGAAAAGGCAGTGG + Intergenic
1097571221 12:61334911-61334933 CATGCACTTGGAAAAGCCATAGG - Intergenic
1097955753 12:65483890-65483912 CATGCACCTGGAAAAGTCACAGG - Intronic
1098253454 12:68592287-68592309 AATGCATCTGGAAAAGCCACAGG - Intergenic
1098559067 12:71851850-71851872 TCTCAGCCTGGAAAAGCCACAGG - Intronic
1098644360 12:72880218-72880240 CCTGCACCTGAAAAAGCCACAGG - Intergenic
1098771550 12:74559462-74559484 TATGCACCTGAAAAAGCCACAGG - Intergenic
1098774929 12:74600583-74600605 TGTGGACTTGGAAAAGTCATAGG + Intergenic
1098836416 12:75429132-75429154 TATGTGCCTGGAAAAGCCACAGG + Intronic
1099352610 12:81591939-81591961 TGTACACCTGGAAAAGCCACAGG + Intronic
1099386487 12:82019115-82019137 CATACACCTGCAAAAGCCACAGG + Intergenic
1099487800 12:83249655-83249677 CATGCACCTGGAAAAGCCACAGG + Intergenic
1099495732 12:83343596-83343618 TCTATGCCTGGAAAAGCCACAGG + Intergenic
1099525242 12:83710864-83710886 TGTGCACCTGGAAAAGACATAGG - Intergenic
1099558985 12:84148965-84148987 CGTGCACCTTGAAAAGCCACAGG + Intergenic
1099587190 12:84533394-84533416 AGTGCACCTGAAAAAGCTGCAGG + Intergenic
1099658728 12:85527924-85527946 TCTGCACTTGGAAAAGCCACAGG + Intergenic
1099669671 12:85674091-85674113 CATGCACCTAGAAAAGCTACAGG - Intergenic
1099675525 12:85755871-85755893 TGTACACCTAGAATATCCACAGG + Intergenic
1099724824 12:86412290-86412312 CATGCACCTGGAAAAGCTGCAGG + Intronic
1099760336 12:86912637-86912659 TGTGTTCCTGGTAAAGCTACAGG + Intergenic
1099978645 12:89572505-89572527 TGTGCACTGGGAAGAGCCAGAGG - Intergenic
1100052126 12:90461502-90461524 CTTGATCCTGGAAAAGCCACAGG - Intergenic
1100230278 12:92600065-92600087 CATGCACCTGGAAAAGCCACAGG - Intergenic
1100263715 12:92956335-92956357 TGTGCACTTAGAAAAGCTTCAGG + Intergenic
1100376142 12:94017864-94017886 TGTGCAACTGGAAAAGCCACAGG + Intergenic
1100597970 12:96087923-96087945 TGTGCACCTGAAAAAGCTACAGG + Intergenic
1101193002 12:102354297-102354319 TGTGCACCTGGAAAAGCCAAAGG - Intergenic
1101361019 12:104027194-104027216 TTTGCACCTGGAAAAGAAATGGG + Intronic
1101516315 12:105438823-105438845 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1101793070 12:107948302-107948324 TGTCCTCCTGGAAAAACCACAGG - Intergenic
1101882666 12:108636181-108636203 TGTGCTCCTGTAACAGCTACTGG - Intergenic
1102507906 12:113395451-113395473 AGTGCAGCTAGAAAAGACACCGG - Intronic
1102726722 12:115072011-115072033 TGACCACCTGGAAAATCCACAGG + Intergenic
1103223634 12:119267649-119267671 TGTGTACCTGTTAAAACCACAGG + Intergenic
1103264630 12:119618443-119618465 CATGCACCTGGAAAAGCCACAGG + Intronic
1103358065 12:120336410-120336432 CATGTGCCTGGAAAAGCCACAGG - Intergenic
1103932756 12:124459302-124459324 TCTTCACCTGCCAAAGCCACAGG + Intronic
1104666817 12:130653487-130653509 TCTGAGCCTGGAAAAGCCACAGG - Intronic
1104777226 12:131397515-131397537 TGTGCACTTGGAAAAGCCACAGG - Intergenic
1105321156 13:19323684-19323706 CCTTCACCTGGAAAAGCCACAGG - Intergenic
1105644518 13:22303046-22303068 TGTGTACCTGGAAAAGCTGCGGG - Intergenic
1105734636 13:23255158-23255180 CTTGAGCCTGGAAAAGCCACCGG + Intronic
1106338901 13:28809583-28809605 CCCGCACCTGGAAAAGCCACAGG + Intergenic
1106993074 13:35447162-35447184 TGTCTACCTGGAATGGCCACAGG - Intronic
1107330753 13:39296837-39296859 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1108155840 13:47584004-47584026 TCTGTACCCTGAAAAGCCACAGG - Intergenic
1108513441 13:51175169-51175191 TGTGCTTCTGGAAAAGCCACCGG + Intergenic
1108771012 13:53700315-53700337 TGGGCACCTGGAAAAGCTGCAGG + Intergenic
1108893631 13:55294950-55294972 CCTGCACCTGGAAAAGCTACAGG + Intergenic
1108911012 13:55551264-55551286 CATGTACCTGGTAAAGCCACAGG + Intergenic
1108950659 13:56088126-56088148 CATGCACCTGGAAAACCCACAGG + Intergenic
1108981774 13:56523458-56523480 CATGCACCTGGAAAAGCCACAGG - Intergenic
1109091559 13:58052499-58052521 CTGTCACCTGGAAAAGCCACAGG + Intergenic
1109130125 13:58574628-58574650 TGGGAAGGTGGAAAAGCCACAGG - Intergenic
1109297470 13:60552494-60552516 CGTGTGCTTGGAAAAGCCACAGG - Intronic
1109476122 13:62882318-62882340 CATCCACTTGGAAAAGCCACAGG - Intergenic
1109481788 13:62964713-62964735 GCTGTACCTTGAAAAGCCACAGG + Intergenic
1109491096 13:63100966-63100988 CTTACACCTGGAAAAGCCACAGG + Intergenic
1109681338 13:65756700-65756722 CATGCTCCTGGAAAAGCTACAGG + Intergenic
1109697390 13:65978128-65978150 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1109717439 13:66234662-66234684 CATGCATCTGGAAAATCCACAGG + Intergenic
1109810764 13:67509661-67509683 TGTGCACCTCAAAAACCCGCAGG + Intergenic
1109962159 13:69645071-69645093 TGTGTGCCTGGAAAAGCCAAAGG + Intergenic
1110008196 13:70297719-70297741 TGGGCACCCGGAAGAGGCACCGG - Intergenic
1110022352 13:70490955-70490977 TGTGCATCTAGAAAAGCTGCAGG + Intergenic
1110033887 13:70654417-70654439 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1110501084 13:76229496-76229518 TGTGGCCCAGGAAAAACCACTGG - Intergenic
1110521256 13:76479530-76479552 TGTGCAAATGGAAAAGACATGGG + Intergenic
1110902148 13:80837036-80837058 TATGCACCTGGAAAAGCCACAGG - Intergenic
1110955301 13:81546316-81546338 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1110955697 13:81549912-81549934 CATGCAACTGGAAAAGCTACAGG - Intergenic
1111065788 13:83089505-83089527 CATGCACCTGGAAAAGCCACAGG + Intergenic
1111085538 13:83371796-83371818 TGTGTACCTGGAAAAGCCGCAGG - Intergenic
1111143871 13:84156187-84156209 TGTGCACCTGAAAAAGCCACAGG + Intergenic
1111144854 13:84166754-84166776 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1111221366 13:85208807-85208829 CATGCACCTGGAAATGCCACAGG + Intergenic
1111222342 13:85220867-85220889 GGTTCATCTGGAAAAGCCACAGG + Intergenic
1111241616 13:85482230-85482252 TGTGTACCTGGCAAAGCCACAGG - Intergenic
1111318101 13:86586846-86586868 TGTGCACCTGGAAAAGCCGTAGG + Intergenic
1111421675 13:88019194-88019216 TGTGAACCTGGAAAAGCCACAGG + Intergenic
1111441363 13:88285895-88285917 TGTGTACCTGGAAAAGTTGCAGG - Intergenic
1111463377 13:88575811-88575833 CCTGCACCTGGAAAAGCCACAGG - Intergenic
1111472003 13:88695496-88695518 AGTGCACCCTGCAAAGCCACAGG - Intergenic
1111641918 13:90980049-90980071 CATGCATCTGGAAAAGCCACAGG - Intergenic
1111718948 13:91917364-91917386 CCTGCACCTTGCAAAGCCACAGG - Intronic
1111753016 13:92358372-92358394 CATGTACCTGGAAAAGCCTCAGG - Intronic
1111778680 13:92694343-92694365 CATGCACCTGGAAAAGCCTCAGG + Intronic
1111889892 13:94068897-94068919 TGTGCACCTGGAAAAGCTGTAGG - Intronic
1112159341 13:96851842-96851864 TGTGGACCTGGAAGTGCCAATGG + Intergenic
1112512285 13:100020458-100020480 AGTGCACCTGGAAAAGCTGCAGG + Intergenic
1112812463 13:103234287-103234309 CATGCACCTGGAAAAGCCACAGG + Intergenic
1113554414 13:111220193-111220215 TGTCCTCCTGGAAAGTCCACTGG - Intronic
1114394488 14:22344644-22344666 TGGGCACCTAGAAAAGGAACAGG - Intergenic
1114433029 14:22678745-22678767 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1114689091 14:24563639-24563661 CCTGCACTTGAAAAAGCCACAGG + Intergenic
1114918493 14:27296556-27296578 TGTGAACCTGGAAAAGCTGCAGG - Intergenic
1114935737 14:27534105-27534127 TGTGCACCTTGAAAAGCCACAGG + Intergenic
1115134295 14:30090646-30090668 CATGTACCTGGAAAAGCCACAGG - Intronic
1115289210 14:31751640-31751662 TGTGCACTTGGAAAAGCCACAGG - Intronic
1115889691 14:38012676-38012698 TTTGCTCCTGGAAAAGCCTCAGG + Intronic
1115944465 14:38644037-38644059 TGTGTGCCTGGAGAAGCCACAGG + Intergenic
1115989973 14:39141402-39141424 CATGCACCTGGAAAAGCCACAGG - Intergenic
1116212995 14:41972121-41972143 AGTGTTCCTGGAAAAGCCACAGG - Intergenic
1116485557 14:45444287-45444309 CATGCACCTGGAAAAGCCACAGG + Intergenic
1116526789 14:45916020-45916042 CCTGCACTTGGAAAAGCTACAGG - Intergenic
1116533916 14:46007297-46007319 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1116542297 14:46113063-46113085 TGTGCACCTGGAAGAGCTGCAGG + Intergenic
1116696443 14:48183595-48183617 CATGCACCTGGAAAAGCCACAGG + Intergenic
1116713355 14:48397342-48397364 CATCCACTTGGAAAAGCCACAGG + Intergenic
1116739268 14:48734277-48734299 TGTGCACCTGGAAAAGTTGCAGG - Intergenic
1116780904 14:49236558-49236580 CGTGCACCTGGAAAAGCCACAGG + Intergenic
1116811193 14:49541425-49541447 CGTGCACCTGGAAAAGGCACAGG + Intergenic
1116986197 14:51222749-51222771 GTTGTACCTGGCAAAGCCACAGG - Intergenic
1116998345 14:51347255-51347277 TATGCACCTGGAAAAGCTGCAGG + Intergenic
1117749280 14:58903388-58903410 TGTACACCTAGAATAGCCACAGG + Intergenic
1117841010 14:59860604-59860626 CATGTGCCTGGAAAAGCCACAGG + Intronic
1117984510 14:61374294-61374316 CTTGCACCTGGAAAAGCCACAGG - Intronic
1118092458 14:62497502-62497524 TATGCACCTGAAAAAGCCGCAGG - Intergenic
1118119937 14:62829207-62829229 TGTGCCCCTGGAAAGGCCACAGG - Intronic
1118301379 14:64619485-64619507 TGAGCACCTGGTGAAGACACAGG - Intergenic
1119862691 14:77947965-77947987 TATGTGCCTGGAAAAGCCATAGG + Intergenic
1119878693 14:78082224-78082246 TGGCCACCTAGAAAAGCAACTGG + Intergenic
1120101604 14:80450988-80451010 CGTGGACCTGGAAAAGCCACAGG + Intergenic
1120225896 14:81790613-81790635 CATGCGCCTGGAAAAGCCACAGG + Intergenic
1120225906 14:81790670-81790692 ACTGTACCTGGCAAAGCCACAGG + Intergenic
1120230601 14:81836808-81836830 TGTGTGCCTGGAAAAGCTGCAGG + Intergenic
1120234672 14:81876493-81876515 AATGCACCTGGAAAAGCCACAGG + Intergenic
1120342998 14:83245413-83245435 TGTGCACCTGGAAAAACCATAGG + Intergenic
1120389543 14:83888485-83888507 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1120590997 14:86373030-86373052 TGTGTGCCTGGAAAAGCTGCAGG + Intergenic
1120623310 14:86792428-86792450 AGTGCACCGGGAAAAGCAGCAGG + Intergenic
1120654114 14:87169086-87169108 TATGCACCTAGAAAAGCTACAGG - Intergenic
1120688284 14:87563862-87563884 CATGCACCTGAAAAAGCCACAGG + Intergenic
1120707700 14:87761533-87761555 CATGCACCTGGAAAATCCACAGG + Intergenic
1120799740 14:88675083-88675105 CATGTGCCTGGAAAAGCCACAGG - Intronic
1121237898 14:92406305-92406327 CGTGCACCTGGAAAAGCCACAGG - Intronic
1121369268 14:93341978-93342000 CATGCACCTGGAAAAGCCACAGG - Intronic
1121384736 14:93509765-93509787 CATGCACCTGGAAAAGCTGCGGG - Intronic
1121448401 14:93992799-93992821 TCTGCACCAGGAAAAGCTCCAGG - Intergenic
1121471224 14:94155897-94155919 GGTGCACCCTGCAAAGCCACAGG + Intronic
1122442373 14:101740916-101740938 TATGCACCTGGAAAAGCTGCAGG - Intergenic
1122831944 14:104402516-104402538 CACGCACCTGGAAAAGCCACAGG + Intergenic
1123064665 14:105611429-105611451 CCTGAATCTGGAAAAGCCACAGG + Intergenic
1123073968 14:105657070-105657092 CCTGAATCTGGAAAAGCCACAGG + Intergenic
1123087969 14:105726653-105726675 CCTGAATCTGGAAAAGCCACAGG + Intergenic
1123093927 14:105756026-105756048 CCTGAATCTGGAAAAGCCACAGG + Intergenic
1123158356 14:106252346-106252368 GGTGTGCCTAGAAAAGCCACAGG + Intergenic
1123408693 15:20040798-20040820 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1123518024 15:21047508-21047530 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1123826964 15:24092155-24092177 TATGTGCCTGGAAAAGCCACAGG - Intergenic
1123841566 15:24253019-24253041 TATGTGCCTGGAAAAGCCACAGG - Intergenic
1123851452 15:24361616-24361638 TATGTGCCTGGAAAAGCCACAGG - Intergenic
1123856351 15:24415988-24416010 TATGTGCCTGGAAAAGCCACAGG - Intergenic
1123875218 15:24617397-24617419 GTTGTGCCTGGAAAAGCCACAGG - Intergenic
1124445023 15:29722719-29722741 CATGCACCTGGAAAAGCCACAGG + Intronic
1124509031 15:30306604-30306626 TGTGCACCTATAAAAACCAAAGG - Intergenic
1124705534 15:31960745-31960767 CTTGCACCTGGAAAAGCCACAGG + Intergenic
1124734526 15:32232058-32232080 TGTGCACCTATAAAAACCAAAGG + Intergenic
1125042127 15:35201033-35201055 TATGCACATGGAAAATCAACTGG - Intergenic
1125066045 15:35487156-35487178 TGTGTGCCTGGAAAAGCCACAGG - Intronic
1125153649 15:36562244-36562266 GTTGCACCTTGCAAAGCCACAGG + Intergenic
1125246517 15:37647250-37647272 CATGTGCCTGGAAAAGCCACAGG + Intergenic
1125806549 15:42498102-42498124 TATGAACCTGGAAAAGCCTCAGG - Intronic
1126190507 15:45873432-45873454 TATGCATCTGGAAAAGCCACAGG - Intergenic
1126220538 15:46208093-46208115 CATGGACCTGAAAAAGCCACAGG + Intergenic
1126794050 15:52245459-52245481 TGTCCACCTGGAAAATCAAAGGG + Exonic
1127012866 15:54649414-54649436 TGTGCAGCTGGAAAAGCCACAGG - Intergenic
1127391901 15:58512560-58512582 AGACTACCTGGAAAAGCCACGGG + Intronic
1128263828 15:66251897-66251919 TGTGCACCAGGAAAATCCGCCGG + Intronic
1128270917 15:66308693-66308715 TATGCTCCTGGAAAAGCAAAGGG - Exonic
1129426910 15:75470056-75470078 TGAGAATCTGGAAAAGCCAGAGG - Intronic
1129454432 15:75669198-75669220 ACTGCACCTGGACAAGCAACTGG - Intergenic
1129715424 15:77845691-77845713 TGTGCACCTGGAAAAGCCCCAGG + Intergenic
1129812738 15:78523985-78524007 CCTGCCCCTGGAAAAGCCACAGG - Intronic
1129900999 15:79149473-79149495 CATGTGCCTGGAAAAGCCACAGG - Intergenic
1130031276 15:80316777-80316799 TGAGCACCTGGACAAGCTAAAGG - Intergenic
1130310879 15:82753088-82753110 TTTGGACATGGACAAGCCACAGG + Intergenic
1130791506 15:87160573-87160595 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1130902032 15:88214571-88214593 ACTGAACCTGGAACAGCCACTGG + Intronic
1131427078 15:92354450-92354472 CGTGCACCTGGAAAAGTCACAGG + Intergenic
1131726782 15:95235061-95235083 TGTGCACCTGGAGAGGCTGCAGG - Intergenic
1132261070 15:100425295-100425317 TATGCACCCGGAAAAGCCACAGG + Intronic
1133043041 16:3070741-3070763 TGTGTGCCTGGAAAAGCCGCAGG - Intronic
1133350092 16:5095679-5095701 GGTGCACCTGGATGAGTCACAGG + Intronic
1134243819 16:12524968-12524990 TTGGCACCTGGAACAGCCCCTGG - Intronic
1134432844 16:14227408-14227430 TGTGCATCTGGCAAGGCCTCAGG - Intronic
1136340817 16:29641965-29641987 TGTGCGCCTAGCAAAGCCAGAGG - Intergenic
1136642420 16:31578038-31578060 CCTGCACCTGGAAAAACCGCAGG + Intergenic
1136663212 16:31783658-31783680 CCTACACCTGGAAAAGCCACAGG - Intronic
1136686420 16:31997255-31997277 TGTGCTCCTGGAGAAGCCCCTGG + Intergenic
1136787031 16:32940784-32940806 TGTGCTCCTGGAGAAGCCCCTGG + Intergenic
1136882741 16:33913005-33913027 TGTGCTCCTGGAGCAGCCCCTGG - Intergenic
1137403796 16:48174676-48174698 TGTGCACTGGGCAAAGCCCCTGG - Intronic
1137638603 16:50009026-50009048 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1137772047 16:51024298-51024320 TGTGCACCTAGCATAGCCCCAGG + Intergenic
1138772840 16:59686164-59686186 TGTGCAGCTGAATAAGCCATAGG - Intergenic
1138800071 16:60016449-60016471 TGTGTGCATGGAAAAGCCACAGG - Intergenic
1139083863 16:63560929-63560951 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1141034280 16:80614326-80614348 TGTGCACCTGGAAGTGGTACTGG - Intronic
1142013235 16:87727836-87727858 TGTGAAGCAGGAAAAGTCACAGG + Intronic
1142093965 16:88229883-88229905 CGTGCCCCTGGGAGAGCCACCGG - Intergenic
1203089270 16_KI270728v1_random:1202454-1202476 TGTGCTCCTGGAGAAGCCCCTGG + Intergenic
1142606972 17:1087414-1087436 GGGGCATCTGGAAAAGCCAGAGG + Intronic
1142909855 17:3079748-3079770 TAGGTGCCTGGAAAAGCCACAGG - Intergenic
1142919497 17:3171882-3171904 CCTATACCTGGAAAAGCCACAGG + Intergenic
1142924647 17:3224061-3224083 TAGGTGCCTGGAAAAGCCACAGG + Intergenic
1143703362 17:8678744-8678766 TGTGCTGGTGGAAAAGCAACTGG - Intergenic
1144324752 17:14168351-14168373 TATGTGCCTGGAAAAGCCAGAGG - Intronic
1144399623 17:14883731-14883753 TGTGTACCTGGAAAAGCAGCAGG - Intergenic
1144493662 17:15734259-15734281 TCTGGTCCTGGAAGAGCCACTGG + Intronic
1144508826 17:15857473-15857495 CGTGCACCCAGAAAAACCACAGG + Intergenic
1144640559 17:16934338-16934360 TCTGGCCCTGGAAGAGCCACTGG - Intronic
1144906603 17:18642393-18642415 TCTGGTCCTGGAAGAGCCACTGG - Exonic
1145172942 17:20675113-20675135 CGTGCACCCAGAAAAACCACAGG + Intergenic
1146008467 17:29177005-29177027 GGTGCACCTGGAAGAGCAGCAGG - Intronic
1146391827 17:32429962-32429984 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1146821675 17:35987832-35987854 TGTGCACATGAGAAAGTCACTGG - Intronic
1147147379 17:38492924-38492946 TGTGCTCCTGGAGAAGTCCCTGG + Intronic
1147539356 17:41344026-41344048 TTTGCACCTGGGAAAGCCCAGGG + Intergenic
1148800952 17:50225460-50225482 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1148842789 17:50509395-50509417 GTTGCACCTGGGAGAGCCACAGG + Intronic
1148857172 17:50585103-50585125 TGTGCAGGTGGACAAGGCACAGG + Intronic
1148983447 17:51599496-51599518 CCTGTCCCTGGAAAAGCCACAGG + Intergenic
1149140483 17:53427471-53427493 TTTAAAACTGGAAAAGCCACTGG + Intergenic
1149145761 17:53490861-53490883 TGTGAACCTGGAAAAGCTGCAGG - Intergenic
1149369397 17:55978221-55978243 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
1150315448 17:64165207-64165229 TGTGCTCCTGGCAAAGAGACTGG + Intronic
1150435769 17:65153026-65153048 GTTGCAGCTGGAAAAGCCAGTGG - Intronic
1150528297 17:65948237-65948259 TTTATACCTGGAAAACCCACTGG - Intronic
1151041082 17:70861551-70861573 CATGCACCTGAAAAAGCCACAGG + Intergenic
1151375624 17:73686839-73686861 GCTGTACCTTGAAAAGCCACAGG + Intergenic
1151810651 17:76439095-76439117 GCTGCCCCTGGAAAGGCCACTGG - Intronic
1152932816 17:83118993-83119015 GGTGGACCTGGAAAAGTCAAAGG + Intergenic
1153108025 18:1550356-1550378 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1153423722 18:4938323-4938345 TGTGGCACTGGAAAAGGCACTGG + Intergenic
1153426820 18:4974593-4974615 GGTGTACCCTGAAAAGCCACAGG - Intergenic
1154178324 18:12105459-12105481 TGTGCACCTGGAAAAGCTGCAGG - Intronic
1154178597 18:12109014-12109036 TGTGCACCTGGAAAAGCTGCAGG - Intronic
1154372250 18:13774824-13774846 TCTGTGCCTGGAAAAGTCACAGG - Intergenic
1154394249 18:13972351-13972373 TGGGAACCTTGAAAAGCCTCAGG - Intergenic
1154486640 18:14877097-14877119 TGAGCACCAGGCAAAACCACAGG + Intergenic
1155354792 18:24941749-24941771 TTTCCATCTGGAAAAGTCACTGG - Intergenic
1155675687 18:28426030-28426052 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1155745859 18:29355910-29355932 CATGCACCTAGAAAATCCACAGG + Intergenic
1155773378 18:29727434-29727456 CCTGAACCCGGAAAAGCCACAGG + Intergenic
1155818596 18:30347447-30347469 TGTGGGCCTGGAAAAGCAGCAGG - Intergenic
1156052318 18:32952103-32952125 CATGTGCCTGGAAAAGCCACAGG - Intronic
1156251064 18:35352883-35352905 CCTGCACTTGGAAAAGCCACAGG + Intergenic
1156484868 18:37458292-37458314 TGTGCACCTGGAAAACTCAGGGG - Intronic
1156858811 18:41813496-41813518 TGTGCTCCTGGAAAAGCCACAGG - Intergenic
1156904410 18:42336692-42336714 CATGTACCTGGAAAAGCCATAGG - Intergenic
1156910741 18:42408757-42408779 CTTGCACCTGGAAAAGCCATAGG - Intergenic
1156914333 18:42447698-42447720 CATGTACCTGGAAAAGCCACAGG - Intergenic
1156936093 18:42709320-42709342 TGTGGCTCTGGAAAAGCCAAGGG - Intergenic
1156995789 18:43465514-43465536 TGTATACATGGAAAAGCCACAGG - Intergenic
1157040000 18:44027564-44027586 TGTGTACCTAGAAGAGCCACAGG - Intergenic
1157251222 18:46098030-46098052 TGTCCAGCCGGAGAAGCCACGGG + Intronic
1157581865 18:48778421-48778443 AATGCACCGGGGAAAGCCACAGG + Intronic
1158020554 18:52836726-52836748 TGTGCACCTGGAAGAGCCACTGG - Intronic
1158129776 18:54139834-54139856 CCTGTGCCTGGAAAAGCCACAGG + Intergenic
1158592031 18:58785799-58785821 TGTGAACTTGGACAAGCCACTGG - Intergenic
1158897356 18:61927539-61927561 TCTGCACATGGCACAGCCACAGG + Intergenic
1159149730 18:64505524-64505546 ACTGCACCTGGAAGAGCCATAGG + Intergenic
1159152093 18:64534191-64534213 CATGCACCTGGAAAAGCCACGGG + Intergenic
1159892274 18:73964134-73964156 CATGCACCTGGAAAAGCCACAGG - Intergenic
1159918469 18:74205977-74205999 TGTGCACCTGTGACAGCCCCAGG - Intergenic
1160253790 18:77229374-77229396 GGTGCAGCTGGTAAAACCACAGG + Intergenic
1160295183 18:77630980-77631002 CGTGCACCTGGAAAAACCACAGG - Intergenic
1160396296 18:78574695-78574717 TGTGTGCCTGGAAAAGGCACAGG + Intergenic
1161948979 19:7456840-7456862 TGTGGGCCTGGAAAACTCACAGG - Intronic
1164489385 19:28692701-28692723 CCTGAGCCTGGAAAAGCCACAGG + Intergenic
1166416679 19:42600367-42600389 TGTGGACCCAGTAAAGCCACTGG + Intronic
1166499422 19:43329813-43329835 ACTGCACCTGGAAAAGCCATAGG - Intergenic
924999753 2:395600-395622 TGTGGCCCTGGGACAGCCACAGG - Intergenic
925456135 2:4018085-4018107 TGGGCACCCTGAAAAGCAACAGG - Intergenic
925489398 2:4375353-4375375 CCTGCACCTGGAAAAGCCACAGG - Intergenic
925661693 2:6209604-6209626 AGTGAGCCTGGAAAAGCCACAGG + Intergenic
925737959 2:6980654-6980676 TGGGCACCTGAAAAAGCTGCAGG - Intronic
926099533 2:10105498-10105520 CATGCACCTGGAAAAGCCACAGG - Intergenic
926221414 2:10938124-10938146 CATGCACCTAGAAAAGCCTCAGG - Intergenic
926335469 2:11859444-11859466 TGTGTCCCTGCAAAATCCACGGG + Intergenic
926434079 2:12820763-12820785 TCTGCACCTGGAAGAGCTCCTGG - Intergenic
926461147 2:13130856-13130878 CATGCACCTGGAAAAGCCACAGG + Intergenic
926598294 2:14814307-14814329 AGTGTGCCTAGAAAAGCCACAGG + Intergenic
926638265 2:15207047-15207069 TGTGCACCTGAAAAAGCCATAGG + Intronic
926734581 2:16063187-16063209 TATGCTCCTGAAAAAGCCACAGG - Intergenic
926769056 2:16351761-16351783 CATGCACCTGGAAAAGCTACAGG + Intergenic
926840960 2:17079880-17079902 CGTGCACCTGGAAAATCCACAGG + Intergenic
926863835 2:17337879-17337901 AGAACACCTGGAAAAGTCACTGG - Intergenic
927033727 2:19150460-19150482 CTTGCACCTGGAAAAGCCACAGG - Intergenic
927170827 2:20367958-20367980 TATACACCTGGAAAAGCTGCAGG - Intergenic
927250274 2:20990287-20990309 TGAACAGCTGGAAAAGCCAGTGG + Intergenic
927302872 2:21536176-21536198 TGTACACCAGGAAAAGCCACCGG + Intergenic
927502623 2:23592519-23592541 TGTGCTCCTGGAGAGGCCCCCGG - Intronic
928749943 2:34459329-34459351 CATCCACCTGGAAAAGCCTCAGG + Intergenic
928797571 2:35040592-35040614 CATGCACTTGGAAAAGCCACAGG + Intergenic
928812637 2:35247894-35247916 TGTGCACCTAGAAAAGCCACAGG - Intergenic
928822054 2:35373147-35373169 TGTGTACCTGGAAAAGCCACAGG + Intergenic
929081652 2:38127881-38127903 TGTGTACCTGGAAAATCCACAGG + Intergenic
929612874 2:43284742-43284764 TGTGTGCCTGGAAAAGCCGCAGG + Intronic
930006824 2:46904383-46904405 CGTGCACCTGGAAAAGCCGCAGG + Exonic
930305336 2:49668332-49668354 CCTGCATCTGGAAAAGCCACAGG - Intergenic
930427794 2:51233902-51233924 GCTGCACCCTGAAAAGCCACAGG - Intergenic
930536069 2:52648006-52648028 TCTGCATATGGAAAAGCCTCAGG - Intergenic
930638199 2:53828867-53828889 TGGGGACCAGGAAAGGCCACCGG + Intergenic
930687576 2:54325784-54325806 TGTGCACGTGCAAAAGCGACAGG + Intergenic
930812960 2:55561497-55561519 CATGCACCTGGAAAAGCCACAGG + Intronic
930961434 2:57266876-57266898 CGTGCACCTGGAAAAGCTGCAGG - Intergenic
931033462 2:58210961-58210983 ACTGTGCCTGGAAAAGCCACAGG - Intronic
931154152 2:59608467-59608489 CATGCACCTGGAAAAGCCACAGG + Intergenic
931529704 2:63199851-63199873 TGTGCACCTGGAAAAACCACAGG + Intronic
931717886 2:65043603-65043625 TGTAAAGCTGGAAAAGCCAAGGG - Intergenic
931955427 2:67418856-67418878 CATGCACCTGGAAAAGCCATAGG - Intergenic
932573371 2:72949978-72950000 TGTCCACCTGGGGAACCCACTGG - Intronic
932648480 2:73530528-73530550 TGTGCACCTGGAAAAGCCACAGG - Intronic
932935639 2:76098275-76098297 CGTGCACCTGGAATAGCCACAGG - Intergenic
932956534 2:76357440-76357462 GGTGTGCCTGGAAAGGCCACAGG + Intergenic
933092497 2:78138182-78138204 CATGTGCCTGGAAAAGCCACAGG + Intergenic
933181347 2:79230692-79230714 CATGTGCCTGGAAAAGCCACAGG + Intronic
933344463 2:81065825-81065847 TGTGCACCTGGAAAAGCCACAGG - Intergenic
933521609 2:83381298-83381320 TGTGCAACTGGAAAAGCTTCAGG + Intergenic
933539341 2:83618884-83618906 TGTGCACCTGGAAAAACCACAGG - Intergenic
934118299 2:88816039-88816061 CAGGCACCTGGAAAAGCCACAGG + Intergenic
934778068 2:96951372-96951394 TCCTCACCTGGAACAGCCACTGG + Exonic
934891884 2:98077946-98077968 CCTGCACCTGGAAAAGCCATAGG - Intergenic
935324640 2:101925150-101925172 CATACTCCTGGAAAAGCCACAGG + Intergenic
935425751 2:102916919-102916941 TGTGTGCCTGGAAATGCCACAGG - Intergenic
935796008 2:106642202-106642224 TGTGCTGCTGGATAATCCACAGG + Intergenic
935798024 2:106664164-106664186 TGTATGCCTGGAAAAGCCGCTGG + Intergenic
935949008 2:108312099-108312121 AGTGCACCTGGAAAAACCACAGG + Intergenic
936014469 2:108947321-108947343 CATGCACTTGGAAAATCCACAGG - Intronic
936292096 2:111234148-111234170 TCTGCATCTGGTAAAGCCTCAGG + Intergenic
936730281 2:115374442-115374464 CATGCACCTGGAAAAGCCACAGG - Intronic
936736285 2:115447000-115447022 TGTGCACCTGGAAAAGCTACAGG + Intronic
936753750 2:115678725-115678747 CGTGCACCTGGAAAAGCTGCAGG + Intronic
936814620 2:116444798-116444820 CATGTGCCTGGAAAAGCCACAGG - Intergenic
936850758 2:116895374-116895396 CATGCACCTGGAAAAGTCTCAGG - Intergenic
937380793 2:121374539-121374561 TGTGTGCCTGGAAAAGCCGCAGG + Intronic
937414003 2:121699900-121699922 TGAGATCCTGGTAAAGCCACAGG + Intergenic
937491351 2:122371466-122371488 TGTAAGCCTGGAAAAGCCAAAGG - Intergenic
937493088 2:122389842-122389864 CACGTACCTGGAAAAGCCACAGG - Intergenic
937560966 2:123223531-123223553 TGTCCACCTGGAAAAGCCACAGG - Intergenic
937726771 2:125176047-125176069 ACTGCACCTGGAAAAGCTGCAGG + Intergenic
937995383 2:127690454-127690476 CCTGCACCTGGAAAAGCCACAGG - Intergenic
938718125 2:134039626-134039648 CATGCACCTGGAAAAGCCTCAGG - Intergenic
938747173 2:134290457-134290479 TTTGCATGTGGAAAAGACACAGG - Intronic
939077926 2:137625707-137625729 TGCCCACCTGAAAAAGCCATAGG - Intronic
939092904 2:137799696-137799718 TGTTCATCTGGAAAAGCTTCAGG + Intergenic
939146864 2:138426029-138426051 TGGGCACCTAGAAAAGGAACAGG + Intergenic
939241973 2:139572893-139572915 CCTGAACCTGGAAAAGCCTCAGG + Intergenic
939361286 2:141175785-141175807 CATGCACCTGGAAAAGGCATAGG + Intronic
939445935 2:142310282-142310304 TGTGCACCTGGAAAATGCACAGG - Intergenic
939581995 2:143961521-143961543 TGTGTACTTGGGAAAGACACAGG - Intronic
939826705 2:147024106-147024128 TGTACACCTGGAAAAGCTTCAGG - Intergenic
939852982 2:147321701-147321723 CATGCACCTGGAAAAGCCACAGG + Intergenic
940425912 2:153531980-153532002 TGTGCACCTGGGAAAGCTGAAGG - Intergenic
940426863 2:153540560-153540582 TATGTACCTGGAACAGCCACAGG + Intergenic
940505387 2:154546910-154546932 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
940578752 2:155549740-155549762 CATGCACCTGGAAAAGACACAGG - Intergenic
940596137 2:155795507-155795529 TGGGTGCCTGGTAAAGCCACAGG - Intergenic
940598031 2:155819519-155819541 CATGCACCTGGAAAAGCTGCAGG + Intergenic
940691381 2:156924396-156924418 CATGTGCCTGGAAAAGCCACAGG + Intergenic
941261849 2:163307223-163307245 TGTGCACCTAGAAAAGCCACAGG + Intergenic
941468875 2:165860580-165860602 TGTGCACCTGAAAAAGTCACAGG - Intronic
941513057 2:166437583-166437605 ACTGCACCTGGAAAAGCCATAGG + Intronic
941525151 2:166597798-166597820 CATTCACCTGGAAAAGCCACAGG - Intergenic
941574087 2:167208936-167208958 TGTGCAGATAGAGAAGCCACAGG + Intronic
941615417 2:167713028-167713050 TGTGCACCTGCAAAATCCATGGG - Intergenic
941811125 2:169756955-169756977 GCTGCACCCAGAAAAGCCACAGG + Intronic
942829750 2:180225497-180225519 TGTGTGCCTGGAAAAGCCACAGG + Intergenic
942889055 2:180965036-180965058 TGTGCAGCTGGAAAAGCCACAGG + Intergenic
942991560 2:182208594-182208616 TGTGCACATGGAAAAGCCACAGG + Intronic
943124805 2:183782998-183783020 TGTGAGCCTGGAAAAGCCACAGG + Intergenic
943214034 2:185007009-185007031 TGTGCACCCTGAAAAGGAACAGG - Intergenic
943238078 2:185347986-185348008 CATGCACCTGGAAAAGTCACAGG + Intergenic
943248390 2:185485083-185485105 CATGCACCTGGAAAAGCCATAGG + Intergenic
944491568 2:200263110-200263132 CATGCACCTAGAAAAACCACAGG + Intergenic
945120759 2:206454927-206454949 CATGCACCTAGAAAGGCCACGGG - Intronic
945333240 2:208562883-208562905 TATGTGCCTGGAAAAGCCACAGG - Intronic
945336577 2:208599665-208599687 CGTGCATCTGGAAAAGCCACAGG - Intronic
945342052 2:208667976-208667998 TGTTGGCCTGGAAAAGCCAATGG + Intronic
945410204 2:209498384-209498406 CCTGCACCTGGAAAAGCCACAGG - Intronic
945713526 2:213330316-213330338 GGTGTACCTTGTAAAGCCACAGG + Intronic
945900709 2:215534373-215534395 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
946048362 2:216840122-216840144 TGGACAGCTGGAAGAGCCACTGG - Intergenic
946543947 2:220716084-220716106 TGTGTGCCTGGAAAAGCTGCAGG - Intergenic
946581018 2:221128285-221128307 TGTGCACCTGAAAAAGCTGCAGG + Intergenic
946760546 2:222989175-222989197 TGTCCACCTGGAAAAGCCACAGG - Intergenic
946805090 2:223463630-223463652 CCTGCACCTGGACAAGCCTCAGG + Intergenic
946930074 2:224662424-224662446 CATGCACCTGGAAAAGCCACAGG - Intergenic
946968679 2:225067780-225067802 TGTACACCTTGAAAAGTCACAGG + Intergenic
947248612 2:228077393-228077415 GCTGTACCTGGCAAAGCCACAGG + Intronic
947488142 2:230571238-230571260 CGTGCACATGGAGAAACCACAGG - Intergenic
948292374 2:236835352-236835374 CATGCACCTGGAAAAGCTGCAGG - Intergenic
948604943 2:239129087-239129109 AGTGCAACTGGAAAAGGAACAGG - Intronic
1168819075 20:761424-761446 CGTGAACCCAGAAAAGCCACTGG - Intronic
1168944392 20:1739578-1739600 ACAGCACCTGGAAAAGCCAGAGG - Intergenic
1169070951 20:2730056-2730078 AGGGCACCTGGAAATGCCAGGGG - Intronic
1169120940 20:3095206-3095228 TGTGGTCCCGGACAAGCCACGGG - Intergenic
1169165012 20:3415491-3415513 CTTGCACCTGGAAAAGCCAGAGG - Intergenic
1169322497 20:4645123-4645145 CCTGAACCTGAAAAAGCCACAGG - Intergenic
1169414319 20:5403005-5403027 TCTGCACCTAGAAAAGCTTCAGG - Intergenic
1169583903 20:7058709-7058731 TCTGCACCCTGCAAAGCCACAGG - Intergenic
1169592879 20:7164345-7164367 CATGCGCCTTGAAAAGCCACAGG + Intergenic
1170122068 20:12922636-12922658 CATGCATCTGGAAAAGGCACAGG + Intergenic
1170318676 20:15069977-15069999 CTTGAGCCTGGAAAAGCCACAGG + Intronic
1170938598 20:20830322-20830344 CATGCACCTGGAAAAGCCACAGG + Intergenic
1171130070 20:22644323-22644345 TGTGCACCTGGAAAAGCCATAGG - Intergenic
1171490715 20:25515113-25515135 TATGCACCTGGAAAAACCACAGG + Intronic
1171777265 20:29380783-29380805 CTTGCACCTAGAAAAGCCAGAGG - Intergenic
1171818682 20:29812558-29812580 CTTGCACCTTGAAAAGCCAGAGG - Intergenic
1171899119 20:30840467-30840489 CTTGCACCTTGAAAAGCCAGAGG + Intergenic
1172893138 20:38281291-38281313 CATGCACATGGAAAAGCCACAGG - Intronic
1173329458 20:42062370-42062392 AGTTCTCTTGGAAAAGCCACTGG + Intergenic
1174279170 20:49426235-49426257 TCTGCATCTGTAAAAGCAACTGG + Intronic
1174965355 20:55208047-55208069 TGTGTGCCTGGAAAAGCTGCAGG + Intergenic
1176794662 21:13362282-13362304 TGAGCACCAGGCAAAACCACAGG - Intergenic
1177085209 21:16694828-16694850 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1177187077 21:17808566-17808588 TGTGCACCTGGAAAAGCTGCAGG + Intronic
1177188601 21:17824669-17824691 CTTGCACCTGGAAAAGCCGTAGG - Intergenic
1177258647 21:18699999-18700021 CATGCACCTGGAAAAGACACAGG + Intergenic
1177268061 21:18809775-18809797 CCTGCACCTGGAAAAGCCATGGG - Intergenic
1177288335 21:19079071-19079093 TCTGCACCTGGAAAAGCCACAGG + Intergenic
1177328792 21:19629274-19629296 CTTGAGCCTGGAAAAGCCACAGG + Intergenic
1177394049 21:20510666-20510688 TGAGCACCTGGAAGAGCCACAGG - Intergenic
1177401784 21:20614298-20614320 TGTGGGCCTGGAAAAGCCACAGG + Intergenic
1177473131 21:21584328-21584350 CATGCAACTGGAAAAGCCACAGG + Intergenic
1177504261 21:22000498-22000520 CATGTGCCTGGAAAAGCCACAGG - Intergenic
1177645861 21:23899299-23899321 CGTGCAACTGGAAAAGCTGCAGG - Intergenic
1177722719 21:24928369-24928391 CCTGCACCTGGGAGAGCCACAGG + Intergenic
1177765210 21:25449970-25449992 CGTGCTCCTGGAAAAGCCACAGG - Intergenic
1177767385 21:25474021-25474043 CATGCACCTGGAAAAGCCACAGG + Intergenic
1177803277 21:25848948-25848970 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1177952152 21:27552042-27552064 TGTGCACCTAGAAAAGCCACAGG - Intergenic
1177965341 21:27719948-27719970 GCTGCACCTTGCAAAGCCACAGG + Intergenic
1178029232 21:28505515-28505537 CCTGCACCTGGAAAAGCCACAGG - Intergenic
1178126991 21:29526566-29526588 TGTGTGCCTGGAAAAGCCACGGG - Intronic
1178154173 21:29832243-29832265 TATACACCTGGAAAAGCCACAGG - Intronic
1178338662 21:31766511-31766533 GGTGCACCTGGAAAAGGCGCAGG + Intergenic
1178883264 21:36465104-36465126 TGGGCACCTGGAGGAGCCTCTGG - Intronic
1179343508 21:40534530-40534552 TGTGGACCTGGAGACTCCACAGG + Intronic
1179639969 21:42741179-42741201 TGTCCACGTGGCAAATCCACAGG + Intronic
1179951853 21:44712686-44712708 TGTGAACCAGGGAAAGCCATCGG - Intergenic
1180152672 21:45959621-45959643 TGTGCACCAGAAACATCCACTGG + Intergenic
1180868473 22:19133135-19133157 TGAGCAGCTTGAAGAGCCACTGG - Exonic
1181448600 22:23000507-23000529 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1181591878 22:23890310-23890332 TGTGACCCTGGACAAGCCACCGG - Intronic
1182892533 22:33830988-33831010 TGTGCCCCTGCAAAATCCATAGG - Intronic
1182945348 22:34316556-34316578 CATGCACCTGGAAAAGCCATAGG + Intergenic
1183004545 22:34890276-34890298 CATGCACCTGGAAAAGCCACAGG + Intergenic
1183582013 22:38731780-38731802 TGTGCTCCTGTAGCAGCCACAGG - Exonic
1184233248 22:43169562-43169584 AGTGCACCTGCAACAGACACAGG + Exonic
1184657406 22:45948675-45948697 TGAGCACCTGGGAGAGCCATGGG + Intronic
1185367961 22:50445617-50445639 CTGGCACCTGGAAAACCCACAGG - Exonic
949128196 3:471229-471251 TGTGCACCTGGAAAAGCCACAGG + Intergenic
949274522 3:2262563-2262585 TGTGAACCTCAAAAATCCACTGG - Intronic
949369380 3:3318165-3318187 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
949471371 3:4400259-4400281 TCTTCACCTGGAAAGGCCATGGG - Intronic
949692337 3:6654692-6654714 TGTGTGCCTGGAAAAGCTGCAGG - Intergenic
950776132 3:15352010-15352032 CCTGTACCTGGAAAAGCCACAGG + Intergenic
951180636 3:19654671-19654693 TGTGCACCTGGAAAAGCCGTAGG - Intergenic
951354615 3:21649106-21649128 TGTACTCCTAAAAAAGCCACAGG - Intronic
951430197 3:22597546-22597568 CATGCACCTGGAAAAGCCACAGG + Intergenic
952096477 3:29960423-29960445 TGTGTACCTGGAAAAGCCACAGG - Intronic
952139197 3:30459371-30459393 CCTGCACCTGGAAAAGCCATAGG + Intergenic
953202210 3:40787641-40787663 TCTGATCCTGGAAAAGCCACAGG + Intergenic
953377974 3:42444790-42444812 CATGCCCTTGGAAAAGCCACAGG + Intergenic
953469015 3:43151030-43151052 TGTACACCTGGGAAAGGCAAAGG - Intergenic
953835398 3:46338862-46338884 TGTGTACCTGGAAAAGCTGGAGG - Intergenic
953898449 3:46823064-46823086 TGTGTACCTGGAAAAGCCATAGG - Intergenic
955167327 3:56527306-56527328 CCTGCACCTGGAAAAGCCACTGG + Intergenic
955356455 3:58236872-58236894 TGGGCACCTGGAAAGGCCTTCGG - Intergenic
955465213 3:59230144-59230166 TGGGCACCTGGAAAAGCCCCAGG - Intergenic
955551159 3:60086824-60086846 CCTCAACCTGGAAAAGCCACAGG - Intronic
955755362 3:62220117-62220139 TGTGCACCAGGAACAGCCAGAGG + Intronic
955833199 3:63026421-63026443 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
955851175 3:63221657-63221679 TGTGAACCTGGGAGAGTCACAGG - Intergenic
956489237 3:69753530-69753552 TCTCAGCCTGGAAAAGCCACAGG + Intronic
956563963 3:70614991-70615013 TCTGAGCCTGGAAAAGCCACAGG - Intergenic
956572499 3:70712458-70712480 TGTATGCCTGGAAAAGCCACAGG - Intergenic
956911436 3:73821849-73821871 CGTGTGCTTGGAAAAGCCACAGG + Intergenic
957087812 3:75698870-75698892 CCTGCACCTGGAAAAGCCAGAGG + Intergenic
957113217 3:75992701-75992723 CATGCACCTGGAAAAGCCACAGG + Intronic
957160248 3:76601216-76601238 CATGCACCTGGAAAAGCTTCAGG - Intronic
957211236 3:77261246-77261268 TGTGTGCCTGGGGAAGCCACAGG + Intronic
957412846 3:79862689-79862711 TGTGCACTTGAAAAAGCCACAGG + Intergenic
957477080 3:80739207-80739229 TGTGCACCTGGAAAAGCCACAGG - Intergenic
957490629 3:80921921-80921943 CCTGCACCTGGAAAAGCCGCAGG + Intergenic
957524169 3:81358438-81358460 TATGCACCTAGAATGGCCACAGG + Intergenic
957576530 3:82015057-82015079 CCTGCACCTGGAAAAGCCACAGG + Intergenic
957609526 3:82449294-82449316 TGTGGGTCTGGAAAAGCCACAGG + Intergenic
957711019 3:83859787-83859809 CATGCACCTGGAAAAGACATGGG - Intergenic
957868064 3:86050385-86050407 TGTGTGCCTGGAAAAGCTTCAGG - Intronic
957909543 3:86603922-86603944 TGTGCACCTGGAGAAGCCACAGG + Intergenic
957929798 3:86863273-86863295 CATTCATCTGGAAAAGCCACAGG + Intergenic
958006087 3:87813163-87813185 TGTGTGCCTGGAAAAGCCACAGG + Intergenic
958084955 3:88795260-88795282 TATGCACCTGGAAAAGCTGCAGG - Intergenic
958256597 3:91332331-91332353 CCTGCACCTGGAAAAGACACAGG + Intergenic
958469433 3:94498886-94498908 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
958518645 3:95156164-95156186 CTTGCACCTGGAAAATCCACAGG - Intergenic
958528426 3:95292189-95292211 CCTGCACCTGGAAAAGCCACAGG + Intergenic
958754565 3:98234980-98235002 TGTGTGCCTGGAAAAACCACAGG + Intergenic
958837171 3:99159033-99159055 CCTGCACCTGGAAAAGCCATAGG - Intergenic
959149495 3:102591517-102591539 CATGCACCTGGAAAAGCTTCAGG + Intergenic
959214763 3:103437428-103437450 TGTGCACCTGCAAAAGCCACAGG - Intergenic
959337008 3:105079451-105079473 AGTGCACCTGGAAAAGCCACAGG - Intergenic
959342495 3:105148964-105148986 CATGCACCTGGAAAAGCCACAGG - Intergenic
959508168 3:107177887-107177909 TGTGCACCTGGAAAAGCTGTAGG - Intergenic
959523389 3:107346275-107346297 TCTGCCCCTGGCAAAACCACAGG + Intergenic
959769244 3:110072651-110072673 CCTGCACCTGGAAAAGCTACAGG + Intergenic
959788445 3:110329211-110329233 TGTGTGCCTGGAAAAGCTGCAGG + Intergenic
959814806 3:110662737-110662759 TGTGCACCTGGAAAAGCCGCAGG + Intergenic
959846647 3:111040791-111040813 CAGGCACCTGGAAAAGCCACAGG + Intergenic
959935332 3:112022913-112022935 CCTGCATCTGGAAAAGCGACAGG + Intergenic
960255414 3:115506126-115506148 CATGCACCTGGAAAAGCTATAGG + Intergenic
960724691 3:120658538-120658560 CGTGCACCTGAAAAAGCCACAGG - Intronic
960842983 3:121978918-121978940 CATGCACCTGGAAAAGCCACAGG + Intergenic
960849517 3:122037270-122037292 CGTGTACCTGAAAAAGCCTCAGG + Intergenic
961067587 3:123889649-123889671 CATGCACCTGGAAAAGCTGCAGG - Intergenic
961148284 3:124613841-124613863 TGACCAGCTGGAAAGGCCACAGG - Intronic
961300456 3:125918677-125918699 GGTGCACCTGGATGAGTCACAGG - Intergenic
961888055 3:130109401-130109423 GGTGCACCTGGATGAGTCACAGG + Intronic
962196426 3:133367670-133367692 AGTGCTCCAGGAGAAGCCACAGG + Intronic
962440145 3:135406077-135406099 TGTGTGCCTTGAAAAGCCACAGG - Intergenic
962649408 3:137473506-137473528 TCTGTACCTGTAAAAGCCTCAGG - Intergenic
963471563 3:145748180-145748202 TGTGCATCTGGAAAAGCTGCAGG - Intergenic
963538896 3:146562150-146562172 TGTCCACCTGGAAAAGCCACAGG - Intergenic
963742197 3:149092042-149092064 CGTGCACCTGGAAAAATGACTGG - Intergenic
964020566 3:152005352-152005374 TGTTCACCTGGAAACCCCACTGG + Intergenic
964076637 3:152700541-152700563 CGTGCACCTGGAAAAGCCACAGG - Intergenic
964154184 3:153564579-153564601 TGTGCACCTAGAAAAGCCATAGG + Intergenic
964279825 3:155052211-155052233 TCTGCACCTGGAAAAGCCACAGG - Intronic
964341931 3:155717245-155717267 ACTGCTCCAGGAAAAGCCACAGG - Intronic
964545385 3:157828441-157828463 CATGCACTTGGAAAAGCCACAGG - Intergenic
964638761 3:158885964-158885986 TGTGGGCCTGGAAAAGCCACAGG + Intergenic
964966135 3:162495888-162495910 TGTATACCTAGAAAAGCCATAGG - Intergenic
965112781 3:164448793-164448815 TGTGAACCTGGAAAAGTCACAGG + Intergenic
965232438 3:166071307-166071329 CCTGCACCTGAAAAAGCCACAGG - Intergenic
965233938 3:166090963-166090985 CTTGCACCTGGAAAAGGCACAGG - Intergenic
965290542 3:166873189-166873211 CATGTCCCTGGAAAAGCCACAGG + Intergenic
965301513 3:167011167-167011189 CATACACCTGGAAAAGCCACAGG - Intergenic
965647350 3:170897836-170897858 CATGTGCCTGGAAAAGCCACAGG + Intronic
965809808 3:172579631-172579653 CGTGCACCTAAAAAAGCCATAGG + Intergenic
965990457 3:174811288-174811310 CTTGCACCTGGAAAAGCCACAGG + Intronic
966007241 3:175030166-175030188 TGTGCAAATGGAAAAGGCAGAGG - Intronic
966075909 3:175936562-175936584 TGTGCACCCGGAAAAGCTGCAGG + Intergenic
966302734 3:178497060-178497082 TGTGTGCATGGAAAAGCCACAGG + Intronic
966452532 3:180078339-180078361 TGTGCACCTGAAAAAGCTGCAGG - Intergenic
966500745 3:180635755-180635777 CATGCACCTTGAAAAGCCGCAGG - Intronic
967260188 3:187634395-187634417 CCTGTACCTGGAAAAGTCACAGG - Intergenic
967396619 3:189016045-189016067 CGTGTACCTGGAAAAGCTGCAGG + Intronic
967406235 3:189119006-189119028 TGTGTGCCTGGAAAAGCCACAGG + Intronic
967509381 3:190291982-190292004 TGTGCACCTGGAAAAGCCACAGG - Intergenic
967567446 3:190988728-190988750 TGTGTGCCTGGAAAAGCTGCAGG + Intergenic
967582787 3:191179452-191179474 CATGTGCCTGGAAAAGCCACAGG + Intergenic
967633936 3:191778701-191778723 CGTGCACCTGGAAAAGCCACAGG + Intergenic
967776974 3:193395086-193395108 TGTGAGCCTGGAAAAGCCACAGG - Intergenic
968518586 4:1025017-1025039 TCTGGGCCTGGCAAAGCCACAGG - Exonic
968530547 4:1089132-1089154 TGTGCACCTAGAAAAGCTGCAGG + Intronic
968997198 4:3953338-3953360 GGTGCACCTGGATGAGTCACAGG + Intergenic
969103666 4:4788952-4788974 CTTGCATCTGGAAAAACCACAGG + Intergenic
969108019 4:4822615-4822637 CGTGTGCCTGGAAAAGCCACAGG + Intergenic
969108204 4:4823994-4824016 TGCAAATCTGGAAAAGCCACAGG - Intergenic
969154986 4:5202408-5202430 TGTGCACCTGGAAAAGCTGCAGG - Intronic
969163167 4:5279512-5279534 TGTGTACCTGGAAAAGCCATAGG - Intronic
969189064 4:5502388-5502410 TGCTCACCTGCAAAAGCCAGGGG + Intergenic
969250342 4:5964005-5964027 TGTGCAACTAGAAAAGCTAGGGG + Intronic
969582336 4:8072598-8072620 TGTGCACCAGGAGAAGACAAAGG + Intronic
969756815 4:9155336-9155358 AGTGCACCTGGATGAGTCACAGG - Intergenic
969816783 4:9692913-9692935 GGTGCACCTGGATGAGTCACAGG - Intergenic
970357451 4:15269810-15269832 TGTGCACCTGGAAAAGACACAGG + Intergenic
970418065 4:15878842-15878864 AGTGCACTGCGAAAAGCCACAGG + Intergenic
970659173 4:18264917-18264939 CATGCACCTGGAAAAGCCACAGG - Intergenic
970715236 4:18913712-18913734 CGTGCACCTGGAAAAGCCACAGG + Intergenic
971141774 4:23932395-23932417 TGTGATCTGGGAAAAGCCACTGG - Intergenic
971277867 4:25215270-25215292 CATGCACCTGGAAAAGCTTCAGG - Intronic
971546319 4:27891371-27891393 CATGTGCCTGGAAAAGCCACAGG + Intergenic
971720879 4:30244184-30244206 CATGCACCTCGAAAAGCCACAGG - Intergenic
971733593 4:30417223-30417245 AGAGCAGCTAGAAAAGCCACAGG + Intergenic
971858880 4:32079143-32079165 CCTGCACCTGGAAAAGCTACAGG - Intergenic
971889906 4:32507074-32507096 TCTGCACCTGGAAAAGCCTCAGG + Intergenic
971892660 4:32544686-32544708 CATGCTCCTGGAAAAGCCACAGG + Intergenic
971972267 4:33635336-33635358 TGTGCACCTAGAAAAGCTGCTGG + Intergenic
971977522 4:33710060-33710082 TGTACACCTGGAAAAGCCGCAGG - Intergenic
972133702 4:35865290-35865312 TCTCAACCTAGAAAAGCCACAGG + Intergenic
972421871 4:38895159-38895181 TGAGCAGCTGGCAGAGCCACTGG - Intronic
972829854 4:42802488-42802510 CCTACACCCGGAAAAGCCACAGG - Intergenic
972847196 4:43004484-43004506 CATGCACCTGGAAAAACCACAGG + Intronic
972878524 4:43395463-43395485 AGTACACCTGGAAAAGCCACAGG + Intergenic
972911467 4:43822371-43822393 CCTGATCCTGGAAAAGCCACAGG - Intergenic
973012429 4:45093338-45093360 CCTGTGCCTGGAAAAGCCACAGG - Intergenic
973032557 4:45361966-45361988 TGTGTACCTGGAAAAGCCACAGG + Intergenic
973046632 4:45541761-45541783 TATGCATCTGGCAAAGCCACAGG + Intergenic
973074310 4:45903859-45903881 AGTGTGCCTGGAAAAGCCACAGG - Intergenic
973614282 4:52663435-52663457 TCTGCACCTGGAAAAGCCACAGG + Intergenic
973707153 4:53592322-53592344 TGTGACCCTGGACAAGTCACTGG + Intronic
973732134 4:53832913-53832935 TTTGCACATGGAAAAGCTGCAGG + Intronic
973780353 4:54283066-54283088 TCTGCACCAGGAAAAACCACAGG - Intronic
974145153 4:57937467-57937489 CGTGTGCCTGGAAAAGCCACAGG + Intergenic
974214480 4:58827850-58827872 TGTGCACCTGGAAAAGCCACAGG - Intergenic
974469180 4:62296635-62296657 TGTGCACCTGGAAAAACTTCAGG - Intergenic
974492762 4:62588451-62588473 TGTGCATTTGGAAAAGCCACAGG - Intergenic
974569680 4:63628396-63628418 TGTGCGCTTGCAAAAGCCACAGG + Intergenic
974573752 4:63689355-63689377 CATGCACCTGGAAAAACCATAGG + Intergenic
974606296 4:64156515-64156537 TGTGTACCTGGAAAAGCTGAAGG - Intergenic
974638059 4:64590908-64590930 CCTGCACCTGGAAAAGCCACAGG - Intergenic
974651175 4:64755527-64755549 CCTGCACCTGGAAAAGCCATAGG + Intergenic
974923417 4:68270000-68270022 TGTGCATCTGGAAAAACCACAGG - Intergenic
974973372 4:68858929-68858951 TGTGCACCTGGAAAAGCCACAGG + Intergenic
974988367 4:69057318-69057340 TGTGTAGCAGGACAAGCCACAGG - Intronic
975052524 4:69883516-69883538 TGTGCACATAGAAAAGCTGCAGG - Intergenic
975629075 4:76381249-76381271 TGTGCACGTGGAAAAACTACAGG + Intronic
976000735 4:80370801-80370823 CCTGTGCCTGGAAAAGCCACAGG - Intronic
976142018 4:82002635-82002657 CATGCACCTGGAAAGGCCACAGG + Intronic
976283314 4:83346713-83346735 TATGCACCTGGAAAAGCTGCAGG - Intergenic
976287520 4:83384823-83384845 TGTGTGCCTGGAAAAACCACAGG - Intergenic
976312208 4:83623371-83623393 CTTGCACCTGGAAAAGGCACAGG + Intergenic
976461151 4:85314311-85314333 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
976776079 4:88707426-88707448 TGTACACTTGGAAATGCCTCTGG + Exonic
976842248 4:89445327-89445349 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
976949741 4:90813801-90813823 CATGTGCCTGGAAAAGCCACAGG - Intronic
977006015 4:91570243-91570265 TGTGTACCTGGAAAAGCCAAAGG - Intronic
977030514 4:91876730-91876752 AGTACACCTGGAAAAGCTGCAGG + Intergenic
977050170 4:92119552-92119574 TGTGTGCCTGGAAAAGCTGCAGG + Intergenic
977339904 4:95744672-95744694 CATACGCCTGGAAAAGCCACAGG + Intergenic
977368305 4:96101655-96101677 TGTGCACCTAGAAAAGACATAGG + Intergenic
977416029 4:96733745-96733767 TGTGCACCTGGGGAAGCTGCAGG + Intergenic
977499480 4:97821414-97821436 CCTGCACCTGGAAAAGCTGCAGG - Intronic
977783465 4:101006096-101006118 TGTGTGCCTGGAGAAGCCACAGG + Intergenic
977942852 4:102877508-102877530 CATGCATCTGGAAAAGCCGCAGG - Intronic
977977779 4:103287015-103287037 TATGCACCTGGAAAAGCCAAAGG + Intergenic
977984002 4:103360547-103360569 TGTGCACCTGGAAAAGCCACAGG + Intergenic
977988571 4:103415124-103415146 AATGCACCTGGAAAAGCTGCAGG + Intergenic
978043616 4:104099624-104099646 TGTGCACCTGGAAAAGCTACAGG + Intergenic
978044274 4:104107108-104107130 TGTGCACCTGGAAAAGCCACAGG + Intergenic
978083359 4:104621133-104621155 CATGCACCTGGAAAAGCCACAGG - Intergenic
978143798 4:105348338-105348360 TTTCCATCTGGAAAATCCACAGG - Intergenic
978206811 4:106089848-106089870 GCTGCACCTTGGAAAGCCACAGG - Intronic
978234888 4:106446549-106446571 GGTGCACCTGGAAAAGCCACAGG - Intergenic
978344908 4:107756757-107756779 CATGCACCTGGAAAAGCCACTGG + Intergenic
978591627 4:110330138-110330160 TGTACACCTGGAAAAGCTAAAGG + Intergenic
978917407 4:114144203-114144225 TGTGCGCCTGGAAAAGACACAGG + Intergenic
979027636 4:115597287-115597309 CCGTCACCTGGAAAAGCCACAGG + Intergenic
979049327 4:115910141-115910163 CGTGTGCTTGGAAAAGCCACAGG - Intergenic
979060851 4:116058974-116058996 CGTGTGCCTAGAAAAGCCACAGG - Intergenic
979125579 4:116968540-116968562 TCTGCACCTGGTAAAGCTGCAGG - Intergenic
979180611 4:117721804-117721826 TGTGCACCTAGAAAAGCCATAGG + Intergenic
979373204 4:119914168-119914190 CATGCATCTGGAAAAGCCTCAGG - Intergenic
979412496 4:120395970-120395992 TGTGCACCTGCAAAAGCCACAGG - Intergenic
979699977 4:123656480-123656502 CATGTACCTGGAAAAGCCATAGG - Intergenic
979703012 4:123689117-123689139 CCTGTGCCTGGAAAAGCCACAGG - Intergenic
979824967 4:125221298-125221320 TGTACATCTGGAAAAGCTGCAGG + Intergenic
979839784 4:125423684-125423706 TATGCACCTGGCAAAGCTGCAGG + Intronic
979951294 4:126897065-126897087 CGTGCACCTGGAAAAGCCATAGG - Intergenic
979956081 4:126955601-126955623 TCTGCACCTGGAACAGGCACCGG - Intergenic
980006900 4:127552667-127552689 CATGTACCTGGAAAAGCCTCAGG + Intergenic
980153664 4:129079628-129079650 TATGTGCCTGGAAAAGCCTCAGG - Intronic
980168099 4:129252609-129252631 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
980247604 4:130267445-130267467 TTTATACCTGGAAAAGACACAGG + Intergenic
980264051 4:130492666-130492688 CATGCGCCTGGAAAAGCCACAGG + Intergenic
980422812 4:132585660-132585682 TTTGTGCCTGAAAAAGCCACAGG + Intergenic
980425091 4:132618101-132618123 CGGGTGCCTGGAAAAGCCACAGG - Intergenic
980458579 4:133076127-133076149 CATGCACCTGGAAAAGCTGCAGG - Intergenic
980702848 4:136455102-136455124 TATGCACCTGGAAAAGCTGCAGG + Intergenic
980732424 4:136840083-136840105 GGTGAAGCCGGAAAAGCCACTGG + Intergenic
981356832 4:143798955-143798977 CATGCTCCTGGAAAAGCTACAGG - Intergenic
981368360 4:143929552-143929574 CATGCTCCTGGAAAAGCTACAGG - Intergenic
981503062 4:145473217-145473239 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
981627640 4:146777037-146777059 TGTGAACATGGCAAAGACACTGG - Intronic
981643264 4:146969249-146969271 TGTGAGCCTGGAAAAGACAGTGG - Intergenic
982390872 4:154862705-154862727 CCTTCACATGGAAAAGCCACAGG - Intergenic
982504892 4:156205314-156205336 CATGCACCTGGAAAAGCTGCAGG - Intergenic
982520956 4:156416446-156416468 CGTGCACCTGGAAAAGCTGCAGG - Intergenic
982597368 4:157403846-157403868 CATGCACCTGGAAAAGCTGCAGG - Intergenic
982797480 4:159663552-159663574 CATGCACCTGGAAAAGCCACAGG - Intergenic
982843285 4:160219723-160219745 CCTGCATCTGAAAAAGCCACAGG - Intergenic
982917178 4:161227204-161227226 TGTGCACCTGGAATAAGCGCAGG - Intergenic
983015577 4:162608184-162608206 CCTGTGCCTGGAAAAGCCACAGG + Intergenic
983048101 4:163011027-163011049 TCTGTACCTTGCAAAGCCACAGG - Intergenic
983089487 4:163487033-163487055 TGTGCTCCTGGAAAAGCTGCAGG - Intergenic
983132807 4:164043064-164043086 TATGTGCCTGGAAAAGCCACCGG - Intronic
983171384 4:164540449-164540471 CATGCTCCTGGAAAAGCCACAGG - Intergenic
983351526 4:166596788-166596810 CCTGCACCTGGAAAAGCAACAGG + Intergenic
983419197 4:167496201-167496223 CATGCACCTGGAAAAGCCACAGG - Intergenic
983665527 4:170177312-170177334 TGTGTACCTGGAAAAGCCACAGG + Intergenic
983825186 4:172250026-172250048 CATGCACCTGGAAAACCCACAGG + Intronic
983836974 4:172400513-172400535 TGTTAAACTGTAAAAGCCACGGG + Intronic
983886840 4:172989124-172989146 TGTGCACATGGAAAAGCTGCAGG + Intronic
983889536 4:173016343-173016365 CATGCACCTGAAAAAGCCACAGG + Intronic
984117110 4:175695324-175695346 TTTGTGCCTGGAAAAGCCATAGG + Intronic
984474112 4:180215526-180215548 TTTGCACCTTGAAAAGTCTCTGG + Intergenic
984571882 4:181404511-181404533 TGTGCATGTAGAAAAGCCACAGG - Intergenic
984731044 4:183068538-183068560 TAGGCACCTGGAAATACCACTGG - Intergenic
985044270 4:185924530-185924552 TGGGCACCAGGAAAAGACAGCGG - Intronic
985135160 4:186778786-186778808 TGTGTACCCTGCAAAGCCACAGG + Intergenic
985183956 4:187296204-187296226 TGTGCACCTGGAAAAACCACAGG - Intergenic
985371770 4:189292601-189292623 CATGAGCCTGGAAAAGCCACAGG + Intergenic
985522064 5:378586-378608 TGTGCACCAGGGGAAGCCACGGG - Intronic
985617730 5:934128-934150 CATGCACCTGGAAAAGTCACAGG - Intergenic
986496197 5:8344315-8344337 TGTACACCTGGAAAAGCCACAGG - Intergenic
986533241 5:8760758-8760780 TGTGCACCTGGAAAAACTGCAGG + Intergenic
986582384 5:9279064-9279086 TGTGTGTCTGGAAAACCCACAGG + Intronic
986744533 5:10731898-10731920 GGTGGCCCTGGAAAAGCCCCAGG + Intronic
986805941 5:11309243-11309265 TGTGCACCTGGAAAAGTCACAGG + Intronic
986949124 5:13060409-13060431 TTTGTGCCTGAAAAAGCCACAGG - Intergenic
987003827 5:13688898-13688920 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
987102526 5:14604898-14604920 CATGCACCTGGGAAAGCCACAGG - Intronic
987542836 5:19277196-19277218 CCTGCACCTGGAAAAGTCACAGG + Intergenic
987543418 5:19283863-19283885 CCTGTACCTGGAAAAGTCACAGG - Intergenic
987697772 5:21354761-21354783 AGTGTGCCTGGAAAAGTCACAGG - Intergenic
988009646 5:25465338-25465360 TGTGCTCCTGGAAAAAACACAGG + Intergenic
988040893 5:25888012-25888034 TGTGTGCCTGGAAAAGCCGCAGG - Intergenic
988080709 5:26411058-26411080 CATGCACCTGGAAAAGCCATAGG + Intergenic
988134914 5:27158319-27158341 TGTGAGCCTGGAAAAGCCACAGG + Intergenic
988162905 5:27544214-27544236 TGTGCACCTGGAAAACCCACAGG + Intergenic
988362592 5:30255241-30255263 GGTGTACCCTGAAAAGCCACAGG - Intergenic
988366815 5:30310636-30310658 CCTGTGCCTGGAAAAGCCACAGG + Intergenic
988386626 5:30574021-30574043 AGTCCACCTGGAAAAGCCACAGG + Intergenic
988579753 5:32458667-32458689 TGTACACCTGGAAAAGCTGCAGG - Intergenic
988647335 5:33108725-33108747 CCTGTGCCTGGAAAAGCCACAGG + Intergenic
988754463 5:34231933-34231955 AGTGTGCCTGGAAAAGTCACAGG + Intergenic
988876999 5:35457621-35457643 ACTGCACCTGAAAAAGCCACAGG + Intergenic
989144519 5:38235362-38235384 TGTGAATCTGGAAAAGCCTTGGG + Intergenic
989224602 5:39011524-39011546 TGGGCGCCTGGAAAAGCCACAGG + Intronic
989254370 5:39350791-39350813 TGTGTACCTGGAAAAGCTGCAGG - Intronic
989817195 5:45750783-45750805 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
990077873 5:51873385-51873407 CATGCACCTGGAAAAGCTGCAGG + Intergenic
990494646 5:56335234-56335256 TGTGCATCTGGAAAAGCCACAGG - Intergenic
990939655 5:61188844-61188866 CATGCACCTGGAAAAGCCACAGG + Intergenic
991186607 5:63815806-63815828 TGTGCACCTGGAAAAGCCACAGG + Intergenic
991600720 5:68349144-68349166 GCTGCACCTTGCAAAGCCACAGG + Intergenic
991742673 5:69697626-69697648 AGTGTGCCTGGAAAAGTCACAGG + Intergenic
991755021 5:69857578-69857600 AGTGTGCCTGGAAAAGTCACAGG - Intergenic
991794246 5:70277364-70277386 AGTGTGCCTGGAAAAGTCACAGG + Intergenic
991822063 5:70572939-70572961 AGTGTGCCTGGAAAAGTCACAGG + Intergenic
991834348 5:70732726-70732748 AGTGTGCCTGGAAAAGTCACAGG - Intergenic
991869700 5:71097973-71097995 CCTGCACTTGGAAAAGCCACAGG + Intergenic
991886625 5:71276906-71276928 GGTGTGCCTGGAAAAGTCACAGG + Intergenic
992954244 5:81891224-81891246 TGTGCACCTGGAAATATCACAGG + Intergenic
993481565 5:88430754-88430776 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
993670353 5:90752848-90752870 TTTCCACCTGGAAAAGGCAATGG - Intronic
993711522 5:91230136-91230158 AGTGCACCTGGAAAAGCTGCAGG - Intergenic
993723936 5:91347597-91347619 TGTGTACCTGGAAAAGCCACAGG - Intergenic
993752826 5:91691810-91691832 CATGTACCTGGAAAAGCCGCAGG - Intergenic
993777039 5:92012462-92012484 CGTGCACCTGGAAAAGCCACAGG + Intergenic
994137185 5:96301832-96301854 CATGCTCCTGGAAAAGCCACAGG - Intergenic
994253861 5:97569967-97569989 TGTGCAGCTGGAAAAGCTGCAGG - Intergenic
994283737 5:97938513-97938535 CATGCACCAGGAAAAGCCACAGG + Intergenic
994425243 5:99576813-99576835 TGTTCACCTGGAAAAGATGCAGG + Intergenic
994436096 5:99735420-99735442 TGTTCACCTGGAAAAGATGCAGG - Intergenic
994439933 5:99789671-99789693 CATGCACCTGGAAAAGCCACAGG - Intergenic
994781462 5:104095322-104095344 CCTGCACCTGAAAAAGCCACAGG - Intergenic
994813712 5:104556821-104556843 CATGTGCCTGGAAAAGCCACAGG - Intergenic
994828591 5:104747430-104747452 GCTGCACCTTGCAAAGCCACAGG + Intergenic
995009428 5:107240761-107240783 TGTGAGCCTGGAAAAGCTGCAGG + Intergenic
995477630 5:112563804-112563826 TGTGTGCCTGGAGAAGCCACAGG + Intergenic
995701418 5:114939473-114939495 TGTGTACATGGAAAAGCCACAGG + Intergenic
995703548 5:114961778-114961800 CATGCACCTGGAAAAGCTGCAGG - Intergenic
996157141 5:120115648-120115670 TGTGAACCTGGAAAAGCTATGGG + Intergenic
996159455 5:120145085-120145107 CATGCACCTGGAAAAGCTACAGG - Intergenic
996232860 5:121087779-121087801 AGTTCTCCTGGAAAAACCACAGG - Intergenic
996235860 5:121128362-121128384 CATGCACCTGGAAAAGCCTCAGG + Intergenic
996238993 5:121171176-121171198 AGTGCACCTAGAAAAGCCACAGG - Intergenic
996273413 5:121636487-121636509 TCTGCATTTGAAAAAGCCACAGG - Intergenic
996453666 5:123656030-123656052 CGTGCACCTGGAAAAGCCACAGG - Intergenic
996587026 5:125100757-125100779 TGTGGACCTGGAAAAGACTGAGG - Intergenic
996829132 5:127720484-127720506 CGTGCCCCTGGAAAAGCTGCAGG - Intergenic
996897689 5:128504375-128504397 TGTGTGCCTAGAAAAGCCACAGG + Intronic
997046990 5:130330538-130330560 TGTACACCTGGAAAAGCTGCAGG + Intergenic
997086519 5:130806400-130806422 CTTGCAACTGGAAAAGCCACAGG + Intergenic
997091525 5:130864327-130864349 TGTATGCCTGGAAAAGTCACAGG - Intergenic
997110280 5:131066933-131066955 TGTGCACCTGGAAAAGCTACAGG + Intergenic
997195593 5:131977165-131977187 TTGGCACCTGGAAAGGCCCCAGG + Intronic
997246645 5:132355521-132355543 CCTGTGCCTGGAAAAGCCACAGG + Intergenic
997274575 5:132573999-132574021 TGTGCACCTGGAAAAACTGCAGG - Intronic
997786517 5:136718644-136718666 TGTTCACCTGAAAAACCCACTGG + Intergenic
997789384 5:136743409-136743431 TGTGCATATGGAAAAGCCAAAGG + Intergenic
997847523 5:137301366-137301388 TGTGAAACTGGGGAAGCCACAGG + Intronic
997856968 5:137381278-137381300 TTTGCTCCTGGAAAAGTCACAGG - Intronic
998209240 5:140181743-140181765 ACTGCACCTGCAAGAGCCACGGG + Intronic
998380881 5:141724551-141724573 CCTGTACCTGGAAAAGCCACGGG - Intergenic
998487742 5:142517627-142517649 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
998745890 5:145259353-145259375 CCTGCACCTGGAAAAGCCACAGG + Intergenic
998800015 5:145859710-145859732 AGTGGACATGCAAAAGCCACGGG + Intergenic
999504369 5:152179861-152179883 TGTGCACCTGGAAAAGCCATAGG - Intergenic
999582584 5:153055776-153055798 CTTGCACCTGACAAAGCCACAGG - Intergenic
999827613 5:155288977-155288999 TGTGAAACTGGAAAAATCACTGG - Intergenic
999906194 5:156143490-156143512 CGTGTTCCTGGAAAAGCCACAGG + Intronic
1000575028 5:162966511-162966533 CATGTGCCTGGAAAAGCCACAGG - Intergenic
1000575450 5:162970091-162970113 CACGCACCTGGAAGAGCCACAGG + Intergenic
1000674634 5:164105694-164105716 TATGCATCTGGAAAAGCCACAGG + Intergenic
1001024190 5:168209569-168209591 GGTGCACTTGGAGTAGCCACAGG - Intronic
1001890712 5:175335865-175335887 TGTGTAACAGGATAAGCCACGGG - Intergenic
1001944384 5:175766706-175766728 TGTGTACCTGGAAAAGCCACAGG - Intergenic
1002196339 5:177503688-177503710 TGTGCCCCTGGAACCGGCACAGG + Intronic
1002778440 6:348443-348465 CGTGCACCTGTTGAAGCCACAGG + Intronic
1002978726 6:2112762-2112784 TGAGGACCAGGAAAAGTCACCGG - Intronic
1003000278 6:2325429-2325451 CATTCACCTGGAAGAGCCACAGG + Intergenic
1003229989 6:4243301-4243323 TCTGTACCTGGAAAAGCCACAGG - Intergenic
1003259739 6:4506485-4506507 TGTGCACTTGGAAAAGCCACAGG - Intergenic
1003690249 6:8346672-8346694 TGGGCACCTGGAAAAGCCACAGG + Intergenic
1003798365 6:9631143-9631165 TGGGCATCTGGAAAAGCCAGAGG + Intronic
1004076819 6:12351352-12351374 CATGTACCTGGAAAAGCCACAGG - Intergenic
1004565122 6:16789037-16789059 CCTTCACCTGGAAAAGTCACAGG - Intergenic
1005101163 6:22173670-22173692 CATGCTCCTGGAAAAGCCACAGG + Intergenic
1005246620 6:23893058-23893080 TGTGCACCTGGTATATCCAAAGG - Intergenic
1005553078 6:26943643-26943665 AGTGTGCCTGGAAAAGTCACAGG + Intergenic
1005597670 6:27394705-27394727 TCTGTGCTTGGAAAAGCCACAGG + Intronic
1005908145 6:30283744-30283766 TGTACAACTGGAAAAGCCACAGG - Intergenic
1006641884 6:35493853-35493875 TGTGTACCTGGAGATGACACTGG - Intronic
1006693305 6:35909155-35909177 CATGTACCTGGAAAAGCCACAGG + Intronic
1007214554 6:40227350-40227372 CTTCAACCTGGAAAAGCCACAGG - Intergenic
1007341371 6:41193296-41193318 TGTGCAGGTGGAAATGACACAGG - Intronic
1007361580 6:41360517-41360539 CTTGCACCTGGAAAAGCCACAGG + Intergenic
1007922938 6:45627059-45627081 TCTGCAACTGGAAATGCCAGTGG + Intronic
1007975230 6:46094718-46094740 CATGTACCTGGAAAAGCCACAGG - Intergenic
1008631412 6:53365973-53365995 CGTGTGCTTGGAAAAGCCACAGG - Intergenic
1008998744 6:57688829-57688851 CCTGCACCTGGAAAAGACACAGG - Intergenic
1009187228 6:60588208-60588230 CCTGCACCTGGAAAAGACACAGG - Intergenic
1009527346 6:64764043-64764065 AGTGTGCCTGGAAAAGCCTCCGG - Intronic
1009680075 6:66880864-66880886 CTTGCACTTGGAAAAGCCACAGG - Intergenic
1009763514 6:68038737-68038759 CATGCACCTGAAAAAGCCACAGG - Intergenic
1009982362 6:70741583-70741605 CATGTACCTGGAAAAGCCACAGG - Intronic
1010061284 6:71625722-71625744 TGTGTACCTGGAAATGCCACAGG + Intergenic
1010430243 6:75769931-75769953 CCTGAACCTGGAAAAGCCACAGG - Intronic
1010517356 6:76789726-76789748 TATGTGCCTGGAAAAGCCACAGG - Intergenic
1010536655 6:77038904-77038926 CAGGCACCTAGAAAAGCCACAGG + Intergenic
1010539100 6:77069412-77069434 TGTGCATCTGGAAAAGCCACAGG - Intergenic
1010594543 6:77748084-77748106 TGTGTGCCTGGAAAAGCCATGGG - Intronic
1010636010 6:78260201-78260223 TGTTAACCTGGAAAAGCCACAGG - Intergenic
1010659729 6:78556097-78556119 CATGAACCTGGAAAAGCCACAGG - Intergenic
1010674079 6:78720956-78720978 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1010900582 6:81423033-81423055 TGTGCACCTAGAAAAGCTGCAGG + Intergenic
1010978276 6:82341090-82341112 TGTGCACCTGGAAAAACCACAGG - Intergenic
1011264023 6:85497082-85497104 CATGTGCCTGGAAAAGCCACAGG - Intergenic
1011294039 6:85807984-85808006 TGTATATTTGGAAAAGCCACAGG - Intergenic
1011382771 6:86760312-86760334 CATGCACCTGGAAAGGCCACAGG + Intergenic
1011504615 6:88028145-88028167 CCTGCACCTGGAAAAGCCCCAGG - Intergenic
1011544544 6:88469159-88469181 CATGCACCTGGAAAAGCTACAGG + Intergenic
1011555715 6:88569950-88569972 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1011981647 6:93386510-93386532 CGTGCACCTGGAAAAGCCACAGG - Intronic
1012076268 6:94690850-94690872 TATGCACCTGGAAAAGTCACAGG - Intergenic
1012120889 6:95365699-95365721 CCTGCATCTGGAAAAGCCACAGG - Intergenic
1012210258 6:96510185-96510207 TATGTGCCTGGAAAAGCCACAGG + Intergenic
1012342349 6:98142887-98142909 CGTGTGCCTGGAAAAGCCACAGG - Intergenic
1012349405 6:98232518-98232540 CATGCACCTGGAAAAACCATAGG - Intergenic
1012424946 6:99103685-99103707 AATGCATCTGGAAAAGTCACTGG - Intergenic
1012475192 6:99609068-99609090 TGTGACCCTGGAGAAGCTACTGG - Intronic
1012751440 6:103168363-103168385 CATGCACCTGGAAAAGCCACAGG + Intergenic
1012765622 6:103363431-103363453 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
1012811617 6:103966658-103966680 CATGCCCCTGTAAAAGCCACAGG - Intergenic
1012823915 6:104123961-104123983 CATGCACCTGGAAAAGCCACAGG + Intergenic
1013553006 6:111228153-111228175 AGTGTAACTTGAAAAGCCACTGG - Intronic
1013904382 6:115198286-115198308 CATCCACTTGGAAAAGCCACAGG - Intergenic
1013928645 6:115503053-115503075 CGTGCGCCTGGAAAAGCCACAGG + Intergenic
1014133928 6:117866255-117866277 GCTGTACCTGGCAAAGCCACAGG - Intergenic
1014153487 6:118085335-118085357 TTTGCACCAGGAAAATCCAAGGG - Intronic
1014236355 6:118960140-118960162 TGGGGATCTGGAGAAGCCACTGG + Exonic
1014245270 6:119061291-119061313 TGTTCACCTGCAAAGGCCACAGG + Intronic
1014450122 6:121572490-121572512 CATGCCCCTGGAAAAGCCACAGG + Intergenic
1014509924 6:122308209-122308231 CTTGAGCCTGGAAAAGCCACAGG + Intergenic
1014661731 6:124180833-124180855 CATGCACCTGGAAAAGCCACAGG - Intronic
1014668746 6:124272700-124272722 CATGCACCTGGAAAAGCCACAGG + Intronic
1014933823 6:127364123-127364145 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1015214308 6:130732216-130732238 AGTGCAGGTGGAAAAGCCAAGGG - Intergenic
1015458634 6:133462048-133462070 TGTAGACCTGGAAGAGACACAGG + Intronic
1015636077 6:135275750-135275772 AATGAACCTGGAAAAGCCACAGG + Intergenic
1015652547 6:135479274-135479296 CATGCACCCAGAAAAGCCACAGG + Intronic
1015777749 6:136831905-136831927 TGTACAGCTGGAAAAGCCACAGG - Intronic
1016094598 6:140020228-140020250 TATGCTCCTGGAAAAGCCACAGG - Intergenic
1016124590 6:140385057-140385079 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1016187914 6:141220990-141221012 TGTGTACATGAAAAAACCACAGG - Intergenic
1016242976 6:141953415-141953437 TGTGTGCCTGGAAAAGCTACAGG + Intergenic
1016256282 6:142109312-142109334 TGAGCACCTGCAAAAGTCACTGG + Intergenic
1016264288 6:142213407-142213429 CATGCACCTGGAAAAGTCACAGG - Intronic
1016613796 6:146024345-146024367 TGTGTGTCTGGAAAAGCCATGGG + Intergenic
1016728317 6:147400809-147400831 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1017580508 6:155859607-155859629 TCTGTACCTGGCAAAGCCACAGG + Intergenic
1017654393 6:156613745-156613767 CTTGCTCCTAGAAAAGCCACAGG - Intergenic
1018051431 6:160012430-160012452 TCTGCATCTGGAGAAGCCTCAGG + Intronic
1018502172 6:164422790-164422812 CGTGTACCTGGAAAAGCTGCAGG + Intergenic
1018527508 6:164729174-164729196 TGTGCTCCTGGAAAAGCTGCAGG + Intergenic
1019449772 7:1091391-1091413 TGGGTACCTGGAGAAGCAACAGG - Exonic
1019453613 7:1113076-1113098 TATGCACCTGGAAAAACTGCAGG + Intronic
1020542157 7:9471218-9471240 TGTGCACCTAGAAAAGCTGCAGG + Intergenic
1020546650 7:9541232-9541254 TGTGAGCCTGGAAAAGCTGCAGG + Intergenic
1020668194 7:11073553-11073575 CCTGAGCCTGGAAAAGCCACAGG - Intronic
1020730213 7:11870225-11870247 TATGCATCTGGAGAAACCACAGG + Intergenic
1020775684 7:12451106-12451128 CCTGCCCCTGGAAAAGCCACAGG + Intergenic
1021019923 7:15584943-15584965 CATGTGCCTGGAAAAGCCACAGG + Intergenic
1021174927 7:17439772-17439794 TGTGTGTCTGGAAAAGCCTCAGG - Intergenic
1021380102 7:19956022-19956044 TATGCACTCTGAAAAGCCACAGG + Intergenic
1021617739 7:22520207-22520229 CTTGCACCTGAAAAAGCCACAGG + Intronic
1021778890 7:24082541-24082563 TTTGTACATGAAAAAGCCACAGG - Intergenic
1022607899 7:31834440-31834462 GCTGCACCTGGAAAAGCCACAGG + Intronic
1022735322 7:33070640-33070662 TATGCACCTGGAAAAGCTGCAGG + Intergenic
1022927328 7:35069683-35069705 CTTGCACCTGAAAAAGCCACAGG + Intergenic
1023030885 7:36089620-36089642 TCTGTGCCTGGAAAAGCCTCAGG + Intergenic
1023188500 7:37555229-37555251 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1023235410 7:38081315-38081337 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1023391449 7:39715075-39715097 CCTGCACTTGGAAAAGCCACAGG + Intergenic
1023690338 7:42779558-42779580 CATGCACCTGGAAAAGCTACAGG + Intergenic
1023690344 7:42779617-42779639 TGTGTACCCTGCAAAGCCACAGG + Intergenic
1023779571 7:43643370-43643392 TGAGAACTTGGAAAAGCCACTGG - Intronic
1024021386 7:45373884-45373906 TGTGTACCCTGCAAAGCCACAGG - Intergenic
1024083940 7:45878218-45878240 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1024373281 7:48610437-48610459 TGCGCTCCTGGAAAAGCCACAGG - Intronic
1024384805 7:48738980-48739002 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1024438525 7:49387989-49388011 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1024667309 7:51559646-51559668 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1024721145 7:52138825-52138847 CATGCACCTGGAAAAGCCACAGG - Intergenic
1024754943 7:52518576-52518598 CCTGCACCTGGAAAAGCCATAGG - Intergenic
1024771725 7:52731508-52731530 TGTGTGCCTGGAAAAGCTGCAGG + Intergenic
1024845489 7:53636951-53636973 TGTGCATCTGGAAAAGCTGCAGG + Intergenic
1024860577 7:53835316-53835338 TCTGCACCTGGAAAAGCTGCAGG + Intergenic
1024926284 7:54618909-54618931 TCTGTACCTGGAAAAGCCACAGG - Intergenic
1025038606 7:55619534-55619556 CATGTGCCTGGAAAAGCCACAGG + Intergenic
1025176323 7:56804166-56804188 GTTGCACCTGGAGAGGCCACCGG - Intergenic
1025221580 7:57114901-57114923 CGTGCACCTAGAAAAGCCACAGG - Intergenic
1025225849 7:57161974-57161996 TGAGCACCTGGAAAAGCCACAGG - Intergenic
1025267388 7:57474891-57474913 TGTGCATCTGGAAAAGCCACAGG + Intergenic
1025368887 7:58980949-58980971 TCTCCACCTGAAAATGCCACAGG - Intergenic
1025407136 7:59659388-59659410 TCTCCACCTGAAAATGCCACAGG - Intergenic
1025418823 7:59866871-59866893 TCTCCACCTGAAAATGCCACAGG - Intergenic
1025419598 7:59880500-59880522 TCTCCACCTGAAAATGCCACAGG - Intergenic
1025632363 7:63286569-63286591 CGTGCACCTAGAAAAGCCAGAGG - Intergenic
1025650198 7:63459664-63459686 CGTGCACCTAGAAAAGCCACAGG + Intergenic
1025695470 7:63772256-63772278 GTTGCACCTGGAGAGGCCACCGG + Intergenic
1025721608 7:64020757-64020779 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1025743634 7:64223556-64223578 TGTGCACCTGGAAAAGCCACAGG + Intronic
1025748764 7:64271985-64272007 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1025858315 7:65303715-65303737 TTTGCACATGGAATAGCCCCTGG - Intergenic
1026625383 7:71987500-71987522 TGGGCACAGGGAAGAGCCACTGG + Intronic
1027180351 7:75935066-75935088 CCTGTCCCTGGAAAAGCCACAGG + Intronic
1027341100 7:77209484-77209506 CGTGCACCTGGAAACGCCACAGG - Intronic
1027584764 7:80044540-80044562 TGGGCACCTGGAAAAGCTATAGG - Intergenic
1027586636 7:80066377-80066399 CCTGCACCTGGAAAAGCTACAGG - Intergenic
1027666526 7:81047486-81047508 TGAGCATCTGGAAAAGCTTCAGG + Intergenic
1027677811 7:81181255-81181277 TCTGTGCCTGGAAAAGCCACAGG + Intronic
1027789099 7:82616310-82616332 TGTGTGTCTGGAAAAGCCACAGG - Intergenic
1027866378 7:83652640-83652662 TGTTCAACTGGAAAAGCTAAAGG - Intergenic
1028011340 7:85648535-85648557 TGTGCATGTGGAAAAGCCACAGG - Intergenic
1028032460 7:85933178-85933200 TGTGCACCTGGAAAAGCCTCAGG + Intergenic
1028045104 7:86108007-86108029 TGTGCACCTGGAAAAGACACAGG + Intergenic
1028048435 7:86152541-86152563 CATGTACCTGGAAAAGCCACAGG + Intergenic
1028054141 7:86222564-86222586 CATGCACCTGCAAAAGCCACAGG - Intergenic
1028140910 7:87274037-87274059 TGTAAACCTGGAAAAGCCACAGG - Intergenic
1028207276 7:88032192-88032214 CATGCACCTGGAAAAGCTGCAGG + Intronic
1028493710 7:91441497-91441519 GGTGCACCCTGCAAAGCCACAGG + Intergenic
1028971655 7:96865888-96865910 TAGGCACCTGGAAGAGCCTCTGG + Intergenic
1030108448 7:106006746-106006768 CATGCACCTGGAAAAGCCACAGG - Intronic
1030868799 7:114731746-114731768 CGTGCACCTGGAAAAGACACAGG + Intergenic
1031254924 7:119435313-119435335 TGAGCACCTGAAAAAGTCATAGG - Intergenic
1031258697 7:119489089-119489111 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1031284210 7:119843460-119843482 CTTGAACCTGGAATAGCCACTGG + Intergenic
1031473571 7:122195906-122195928 TCTGCACCTGGAGAGGGCACAGG - Intergenic
1031626790 7:124001369-124001391 CATGAACCTGGAAAAGCCACAGG - Intergenic
1031652106 7:124303715-124303737 TGTGCACCTCGAAAAGCCACAGG + Intergenic
1031722509 7:125194044-125194066 ACTGCACCTTGCAAAGCCACAGG + Intergenic
1031732912 7:125320224-125320246 CCTGCACCTGGAAAAGCCTCAGG + Intergenic
1031749643 7:125556177-125556199 CATGCATCTGGAAAAGCCACAGG - Intergenic
1031771364 7:125848312-125848334 CTTGTGCCTGGAAAAGCCACAGG + Intergenic
1031796039 7:126175557-126175579 TCTCAGCCTGGAAAAGCCACAGG + Intergenic
1031914076 7:127546086-127546108 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1032124917 7:129186812-129186834 TCTGCTCCTGGAGAAGCCTCAGG + Intergenic
1032366813 7:131307446-131307468 TGTGCACCTGGAAAAGCTGCAGG + Intronic
1032561028 7:132893094-132893116 AGTGCACCTGGAAACGTCACAGG + Intronic
1033415993 7:141161622-141161644 TGTTCCCCTGGAAGAGCCTCTGG - Intronic
1033784876 7:144718168-144718190 CCTGCACCTGGAAAAGCTGCAGG + Intronic
1033908458 7:146235663-146235685 TGTGCACCTGAAAACACCACAGG - Intronic
1034532947 7:151707995-151708017 TGTCCACCTGCAAAGGCCCCCGG + Intronic
1034573096 7:151972992-151973014 CATGCACTTGGAAAAGACACAGG + Intronic
1034689250 7:153000751-153000773 TGTGCACCTGGAAAAGCTTAAGG - Intergenic
1034876109 7:154726122-154726144 CATGCATCTGGAAAAGCCCCAGG - Intronic
1034876571 7:154729855-154729877 GCTACACCTGAAAAAGCCACTGG + Intronic
1035547959 8:498201-498223 CATGCACCTGAAAAAGCCACAGG + Intronic
1036380046 8:8230656-8230678 GGTGCACCTGGATGAGTCACAGG - Intergenic
1036518536 8:9468736-9468758 TGTGTGCCTGGAAAAGCCACAGG + Intergenic
1036849513 8:12192006-12192028 GGTGCACCTGGATGAGTCACAGG + Intronic
1036870875 8:12434279-12434301 GGTGCACCTGGATGAGTCACAGG + Intronic
1037364089 8:18104062-18104084 CCTGCACCTGGAAAATCCACAGG + Intergenic
1037415863 8:18649181-18649203 CCTGCACCTGGAAAAGCCATAGG + Intronic
1039148647 8:34478913-34478935 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1039657236 8:39423226-39423248 CATGCACCTGGAAAAGCCACAGG - Intergenic
1039888435 8:41668783-41668805 TGTCCAGGTGGAAAGGCCACTGG + Intronic
1040078024 8:43259981-43260003 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
1040091235 8:43400970-43400992 CATGCACCTGGAAAAGCCACAGG - Intergenic
1040645056 8:49388244-49388266 TGTGCACCTGGAAATGCCACAGG + Intergenic
1040945894 8:52883655-52883677 TGTGCACCTGGACAAGCTACAGG - Intergenic
1041386711 8:57312159-57312181 CGTGAGCGTGGAAAAGCCACAGG + Intergenic
1041430715 8:57778007-57778029 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1041479743 8:58306992-58307014 CGTGTACCTAGAAAAGTCACAGG - Intergenic
1041491538 8:58438370-58438392 CCTGAGCCTGGAAAAGCCACAGG + Intronic
1041549071 8:59079821-59079843 TCTGAGCCTGGAAAAGCCACAGG + Intronic
1041631755 8:60096526-60096548 TGTGCACCTAGAAAAGCTGCAGG - Intergenic
1041632041 8:60099375-60099397 TGTGTACCTGGAAAAGCTGCAGG - Intergenic
1041984779 8:63909106-63909128 GCTGTACCTGGCAAAGCCACAGG - Intergenic
1042071579 8:64941199-64941221 TGTGCACCTTGAAAAGCCACAGG - Intergenic
1042181017 8:66087873-66087895 CAAGAACCTGGAAAAGCCACAGG - Intronic
1042501593 8:69515001-69515023 TCTGCACCTACAAAAGCCACAGG - Intronic
1043030788 8:75131079-75131101 CATGCACCTGGAAGAGCCACAGG + Intergenic
1043145449 8:76648196-76648218 TGTGCACTTGGATAAGCCACAGG + Intergenic
1043199142 8:77340634-77340656 TGTGCACTTGGATAAGCCACAGG + Intergenic
1043214550 8:77569534-77569556 TGTGAGACTGGAAAAGCCACAGG - Intergenic
1043334062 8:79151363-79151385 CCTCAACCTGGAAAAGCCACAGG + Intergenic
1043384186 8:79732032-79732054 GCTGTGCCTGGAAAAGCCACAGG - Intergenic
1043533595 8:81176258-81176280 CTTGCACCTGAAAAAGCCACAGG - Intergenic
1043812030 8:84753013-84753035 TGTGTGCCTGGAAAACCCATGGG + Intronic
1044040172 8:87357318-87357340 TCTGAGCCTGGAAAAGCTACAGG + Intronic
1044051866 8:87515460-87515482 CATGCACCTGGAAAAGCCACAGG + Intronic
1044086311 8:87946036-87946058 TGGGCACCTAGAAAAGGAACAGG - Intergenic
1044295193 8:90519135-90519157 TGTGCACGTGGAAAAGCTGCAGG + Intergenic
1044504637 8:93004004-93004026 TGTGCACCTGGAAAAGCCACAGG - Intronic
1045079050 8:98604412-98604434 TATGCACTTGGAAAACCCATAGG - Intronic
1045422119 8:102026630-102026652 TGTGTGCCTGAAAAAGCCACAGG - Intronic
1045436960 8:102173411-102173433 TCTGCACCTGGAAAAGCTGCAGG - Intergenic
1045438876 8:102190592-102190614 TCTGCACCTGGAAAAGCCACAGG - Intergenic
1045597155 8:103669833-103669855 TGTGCACCTGGAAAAGCCACAGG - Intronic
1045700665 8:104862748-104862770 CCTGTACCTGCAAAAGCCACAGG + Intronic
1045849326 8:106674124-106674146 TGTGCACCTGGAAAAGTTGTAGG + Intronic
1045875861 8:106979878-106979900 GGTGCACTTGGAAGAGACACAGG + Intergenic
1046175526 8:110570860-110570882 CATGCACTCGGAAAAGCCACAGG - Intergenic
1046267185 8:111846289-111846311 CCTTCACCTGGAAAAGCCACAGG - Intergenic
1046352473 8:113033254-113033276 CATGTGCCTGGAAAAGCCACAGG + Intronic
1046358394 8:113117626-113117648 TGTTCACCTGGAAAAGCCGAAGG + Intronic
1046495593 8:115010063-115010085 TGTGGGCCTGGAAAAGCTGCAGG - Intergenic
1046668807 8:117035513-117035535 CCTGCACCTGGAAAAGCTTCAGG - Intronic
1046786438 8:118271920-118271942 TGTGAGTCTGGAAAAGCCACAGG - Intronic
1046814812 8:118571969-118571991 CATGGGCCTGGAAAAGCCACAGG + Intronic
1046826144 8:118694422-118694444 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1046863154 8:119117386-119117408 CATGTGCCTGGAAAAGCCACAGG - Intergenic
1046878010 8:119277548-119277570 CTTGTACCTGGAAAAGCCACAGG - Intergenic
1046889003 8:119400772-119400794 CCTGCATCTGGAAAAGCCACAGG + Intergenic
1047586945 8:126283123-126283145 CACGCACCTGGAAAACCCACAGG + Intergenic
1047688291 8:127323423-127323445 CCTGAGCCTGGAAAAGCCACAGG + Intergenic
1047717213 8:127606656-127606678 TCTGCACCTGGAACAGTGACTGG - Intergenic
1047869989 8:129071773-129071795 AGTACACCTGGAAAAGCTGCAGG + Intergenic
1047923342 8:129657524-129657546 CATGCACCTGGAAAAGCCACAGG - Intergenic
1047937699 8:129798400-129798422 TGTGCACCTGGAAAAGCAGCAGG - Intergenic
1048038963 8:130706751-130706773 TGTGTACCTAGAAAAGCCACAGG - Intergenic
1048043281 8:130750914-130750936 CATGCACTTAGAAAAGCCACAGG - Intergenic
1048213482 8:132476369-132476391 TGTGTGCCTGGAAAAGCCACAGG + Intronic
1048292581 8:133191944-133191966 TCTGCACCTCCAAAAGCCAGGGG + Intronic
1048526288 8:135205964-135205986 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1048537647 8:135312570-135312592 TGTGTGCCTAGGAAAGCCACAGG - Intergenic
1048782514 8:138017472-138017494 TGTGCACCTAAAGAAGCCATAGG + Intergenic
1048789975 8:138093084-138093106 TGTGCACCTGGAAAAGTTGCAGG - Intergenic
1049064960 8:140305951-140305973 TGTAAAATTGGAAAAGCCACTGG - Intronic
1049489586 8:142888203-142888225 CATGCACCTGGAAAAGCCATAGG - Intronic
1049589241 8:143448653-143448675 CATGCACCTGGAAAAGCTGCAGG - Intronic
1049687584 8:143945083-143945105 GGTGCTCTTGGAAAGGCCACAGG + Intronic
1050074901 9:1853220-1853242 TCTGATCTTGGAAAAGCCACAGG + Intergenic
1050079844 9:1904580-1904602 CATGCACCTGGGAGAGCCACAGG + Intergenic
1050109492 9:2200159-2200181 CAGGAACCTGGAAAAGCCACAGG - Intergenic
1050288684 9:4130871-4130893 CCTGCACCTGGAAAAGCCACAGG + Intronic
1050674478 9:8036617-8036639 CCTGTGCCTGGAAAAGCCACAGG - Intergenic
1050907760 9:11027090-11027112 CCTGTGCCTGGAAAAGCCACAGG - Intergenic
1051865157 9:21672162-21672184 TTACAACCTGGAAAAGCCACAGG + Intergenic
1051925251 9:22317264-22317286 TGTGTACCTGGAAAAGCTGCAGG + Intergenic
1052004588 9:23330641-23330663 TCTGTGCCTGGAAAAGCCGCAGG + Intergenic
1052090429 9:24320598-24320620 CATGCACCTGGAAAACCCACAGG - Intergenic
1052168010 9:25357484-25357506 TGTGCACTTGGAAAAGTTGCAGG - Intergenic
1052175955 9:25463330-25463352 TGTGTGCCTCAAAAAGCCACAGG - Intergenic
1052179337 9:25505342-25505364 TGTGCACCTGGCAAAGCTGCAGG - Intergenic
1052208267 9:25869882-25869904 CATGTGCCTGGAAAAGCCACAGG - Intergenic
1052428670 9:28338091-28338113 GATGTACCTGGCAAAGCCACAGG + Intronic
1052522261 9:29563182-29563204 TGTGTAACTGAAAAAGCCTCAGG + Intergenic
1052995546 9:34550031-34550053 TGTTCAGCTTGAAAAGCCACAGG + Intergenic
1053084238 9:35204444-35204466 ACTGTGCCTGGAAAAGCCACAGG + Intronic
1053125911 9:35580701-35580723 CATGTGCCTGGAAAAGCCACAGG + Intergenic
1053264200 9:36698725-36698747 CATGCAACTGGAAAAGCCTCAGG - Intergenic
1053619687 9:39802663-39802685 TGTGTGCCTGAAAAAGCCACAGG + Intergenic
1053877862 9:42561979-42562001 TGTGTGCCTGGAAAAGCCACAGG + Intergenic
1053887571 9:42655906-42655928 TGAGCACCAGGCAAAACCACAGG + Intergenic
1053894794 9:42732387-42732409 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
1054226593 9:62463356-62463378 TGAGCACCAGGCAAAACCACAGG + Intergenic
1054233833 9:62539715-62539737 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
1054264471 9:62904780-62904802 TGTGTGCCTGAAAAAGCCACAGG - Intergenic
1054267822 9:62937104-62937126 CATGTGCCTGGAAAAGCCACAGG + Intergenic
1055698685 9:78917520-78917542 TGTGTGCCTGGAAAAGCCGCAGG + Intergenic
1055878518 9:80971004-80971026 TGTGTGTCTGGAAAAGCCACAGG + Intergenic
1056192647 9:84199275-84199297 CCTGCACCTGGAAAAGCTGCAGG - Intergenic
1056625812 9:88252238-88252260 TGTGCACCTGAAAAATCCACAGG + Intergenic
1056915022 9:90738855-90738877 TGTGTGCCTGGAAAAGCCTCAGG - Intergenic
1057285297 9:93748854-93748876 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1058274624 9:103024383-103024405 GGTGTACCCTGAAAAGCCACAGG + Intergenic
1059110708 9:111556321-111556343 CATGCACCTGGAAAAGTCACAGG - Intronic
1059187100 9:112284221-112284243 CATGCGCCTGGAAAAGCCACAGG + Intronic
1059581702 9:115556185-115556207 CATGCACCTGAAAAAGCCACAGG - Intergenic
1059605028 9:115825051-115825073 TGTGCACCTGGAAAAGCCAGAGG + Intergenic
1059617517 9:115967236-115967258 GGCGTGCCTGGAAAAGCCACAGG - Intergenic
1059738014 9:117121755-117121777 TCTGCATCTGGGGAAGCCACAGG + Intronic
1060019612 9:120117762-120117784 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1060235920 9:121862626-121862648 GGTGCACCTGGACAAGCCAAGGG - Intronic
1061036732 9:128118460-128118482 TGTGCAGCTGGAAAGGCATCAGG + Intergenic
1061891773 9:133625468-133625490 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1062077721 9:134600965-134600987 TGGGAAGCTGGAAAAGCCAGAGG - Intergenic
1062145108 9:134984777-134984799 TGTGCAACCTGAAAAGCCTCTGG + Intergenic
1062236775 9:135514054-135514076 TGGGCACCTGGTAGAGCCATAGG - Intergenic
1062438825 9:136559931-136559953 TGTGTGCCTGGAAAAGCCACAGG + Intergenic
1062465496 9:136679100-136679122 TGTGCACCCGGAAAAGGCCAAGG - Intronic
1185542006 X:909961-909983 GGTTCACCTGGAAACTCCACAGG - Intergenic
1185750688 X:2608365-2608387 TGTGCCCCTGGATCAGACACAGG - Intergenic
1186372828 X:8965084-8965106 TATGCACCTGGAAAAGCCACAGG - Intergenic
1186524211 X:10233403-10233425 TGTCCACATGGAAAAGGCACTGG + Intronic
1186539032 X:10381430-10381452 GGTCCTTCTGGAAAAGCCACAGG - Intergenic
1186742659 X:12534472-12534494 CATGCACCTGGAAAAGCTGCAGG + Intronic
1187133551 X:16525788-16525810 CGTGTGCTTGGAAAAGCCACAGG - Intergenic
1187225555 X:17373072-17373094 TGTGCTCTTGGAAAGGTCACTGG + Intergenic
1187663166 X:21573282-21573304 TGTGCTCCTGGAAAAGCTGCAGG - Intronic
1187843230 X:23509914-23509936 CCTGCACCTGGAAAGGCTACAGG + Intergenic
1188041747 X:25376760-25376782 CATGCGCCTGGAAAAGCCACAGG + Intergenic
1188041760 X:25376820-25376842 GCTGCACCTTGCAAAGCCACAGG + Intergenic
1188073176 X:25743047-25743069 TGTGCACCTGTAACAGTGACTGG - Intergenic
1188105576 X:26143840-26143862 TATGCACCTGGAAAAGCTGCAGG - Intergenic
1188115557 X:26238630-26238652 TGCGCACCTGGAAAAGCTGCAGG - Intergenic
1188162393 X:26819724-26819746 TGTGCATCTGGAAAAGCTGCAGG + Intergenic
1188166459 X:26870256-26870278 CCTACACCTGGAAAAGCCACAGG - Intergenic
1188305672 X:28557893-28557915 TGTGTGCCTGGAAAAGCCACAGG - Intergenic
1188873090 X:35398291-35398313 TGTGTTCCTGGAAAAGCTGCAGG - Intergenic
1188954133 X:36414257-36414279 TCTTAACCTGGAAAAGCCACAGG - Intergenic
1188964770 X:36537405-36537427 TGTGCACCTAGAAAAGCCACAGG + Intergenic
1189011392 X:37049001-37049023 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1189011846 X:37053700-37053722 CTTGTGCCTGGAAAAGCCACAGG + Intergenic
1189035074 X:37487497-37487519 TGTGCACCTAGAAAAGCTGCAGG - Intronic
1189036861 X:37502587-37502609 CTTGTGCCTGGAAAAGCCACAGG - Intronic
1189553051 X:42113323-42113345 TGAGCACCTGGAAAAGCCACAGG - Intergenic
1189788759 X:44583590-44583612 TGTGCACCTGGAAAACTTGCAGG + Intergenic
1189831923 X:44983302-44983324 TGTATAACTGAAAAAGCCACCGG - Intronic
1190252384 X:48737081-48737103 TGTGCACCTGTAAAAGAAGCTGG - Intergenic
1190387649 X:49898350-49898372 TGTGTGTCTGGAAAAGACACAGG + Intergenic
1190915096 X:54805671-54805693 TTTCCACCTGGACATGCCACAGG + Intergenic
1191052254 X:56206684-56206706 AATGCACCTGGAAAAGCTACAGG - Intergenic
1191122739 X:56922816-56922838 TCTGCTCCTTGAAAGGCCACAGG - Intergenic
1191656576 X:63605124-63605146 CATGCATCTGGAAAAGCCACAGG + Intergenic
1191674215 X:63777922-63777944 TGTGTGCCTGGAAAAGCCATGGG - Intronic
1191693092 X:63960927-63960949 TGAGCACGTGGAAAAAGCACAGG + Intergenic
1191710949 X:64149558-64149580 CGTGCACCTGAAAAAGCTGCAGG - Intergenic
1191737965 X:64407233-64407255 TCTGCACCTTTAAAAGCCACAGG - Intergenic
1191923180 X:66279079-66279101 TGTGAACCTGGAAAATCTGCAGG - Intergenic
1191926548 X:66317348-66317370 TCTGCACCTGGAAAAGTTTCTGG + Intergenic
1191982427 X:66941117-66941139 TGTGCACGTGGAAAAGCCACAGG + Intergenic
1192066657 X:67891941-67891963 CATGCACCTGGAAAAACCACAGG + Intergenic
1192696022 X:73416844-73416866 TCTGTGTCTGGAAAAGCCACAGG - Intergenic
1192923148 X:75729122-75729144 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1192937020 X:75870902-75870924 CCTGCATCTGGAAAAGCTACAGG + Intergenic
1193058756 X:77182199-77182221 TCTGCTCCTGGAAAAGCCACAGG + Intergenic
1193068362 X:77281346-77281368 CATGCACCTGGAAAAGCTGCAGG + Intergenic
1193226022 X:78985383-78985405 CATGACCCTGGAAAAGCCACAGG - Intergenic
1193256513 X:79355245-79355267 CGTGAGCCTGGAAAAGTCACAGG + Intergenic
1193329689 X:80222556-80222578 TGTGTGCTTGGAAAAGCCACAGG + Intergenic
1193332985 X:80256311-80256333 TGCGTACCTGGAAAAGCCACAGG + Intergenic
1193406477 X:81107669-81107691 CCTGCACCTGGAAAAGCCCCAGG + Intergenic
1193421786 X:81292008-81292030 CGTGGACCTGGTAAAGCCACAGG - Intronic
1193468635 X:81874662-81874684 GGTGCACCTGGTCCAGCCACAGG - Intergenic
1193489661 X:82133780-82133802 TGTGCACCTGAAAAAGCCACAGG - Intergenic
1193492089 X:82162512-82162534 TGTGCACCTGGAAAAACTTCAGG + Intergenic
1193497420 X:82231865-82231887 TGTGCTTCTGGAAAAGCTGCAGG + Intergenic
1193506194 X:82347852-82347874 TATGCACCTGGAAAAGCTTCAGG - Intergenic
1193527608 X:82612470-82612492 ACTGTACCTGGAAAAGCCACAGG + Intergenic
1193558373 X:82984963-82984985 TGTGTACCTGGAAAAGCGAAAGG - Intergenic
1193795335 X:85866611-85866633 CATGCACCTGGAAAAGTCACAGG + Intronic
1193801944 X:85946820-85946842 CCTGCACCTGAAAAAGCCACAGG + Intronic
1193850536 X:86531825-86531847 CATGAACCTGGAAAAGCCGCAGG + Intronic
1193871541 X:86804939-86804961 TATGAACCTAGAAAAGCCACAGG - Intronic
1193948151 X:87764029-87764051 TGTGCATCTGGAGAAGCTACAGG - Intergenic
1193962896 X:87947524-87947546 CGTGTGCCTGGAAAAGCCACAGG + Intergenic
1193995949 X:88366075-88366097 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1194019466 X:88668958-88668980 CTTGAACCTGGAAAGGCCACAGG - Intergenic
1194038814 X:88914954-88914976 TGTGCACCTCGAAAAGCTGCAGG - Intergenic
1194043292 X:88970343-88970365 TGTGCATCTGGAAAGGCCATAGG - Intergenic
1194053776 X:89104946-89104968 TGTGCACCTGTAAATGCTGCAGG - Intergenic
1194064222 X:89241853-89241875 CATGCACCTGGAAAAGCCACAGG + Intergenic
1194084555 X:89509898-89509920 TGTGTGTCTGGAAAAGCCACAGG - Intergenic
1194135030 X:90130637-90130659 TATGCACCTTGAAAAGCTGCAGG + Intergenic
1194150776 X:90323228-90323250 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1194169527 X:90564496-90564518 AATGCACCTGGAAAAGACACAGG + Intergenic
1194199863 X:90941385-90941407 CATGCACCTGGAAAAGCCGCAGG - Intergenic
1194206259 X:91015158-91015180 CATGCACCTGAAAAAGCCACAGG - Intergenic
1194244347 X:91493172-91493194 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1194300637 X:92182024-92182046 TGTGTACCTGGAAAAGCCACGGG + Intronic
1194302920 X:92209602-92209624 TGTGCACCTAGAAAAGCCACAGG - Intronic
1194313208 X:92340265-92340287 TGTGCACCTGGAAAAGCTGCAGG - Intronic
1194418144 X:93638232-93638254 CGTGCACCTGGAAAAGCTGCAGG + Intergenic
1194435115 X:93860237-93860259 CACACACCTGGAAAAGCCACAGG + Intergenic
1194507128 X:94746246-94746268 TCTGTACCTTGCAAAGCCACAGG + Intergenic
1194563076 X:95447128-95447150 GATGCACCTGGAAAAGCCACAGG - Intergenic
1194572892 X:95574667-95574689 TCTGCCTGTGGAAAAGCCACAGG + Intergenic
1194590845 X:95798021-95798043 CCTTCACCTGGAAAAGCCACAGG + Intergenic
1194943550 X:100041533-100041555 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1195356012 X:104040441-104040463 TGAGCACCTGGGAAACCCAAAGG + Intronic
1195822127 X:108956818-108956840 CTTGCACCTGGAAAAGCCACGGG + Intergenic
1196173691 X:112617220-112617242 CATGCACCTGGAAAAACCATAGG + Intergenic
1196223513 X:113139120-113139142 CGTGCTCCTGGAAAAGCCTCAGG - Intergenic
1196390601 X:115203806-115203828 CGAGCACCTGGAAAAGCTGCAGG - Intronic
1196480500 X:116141851-116141873 CACGCACCTGGAAAAGCCACAGG + Intergenic
1196582499 X:117393767-117393789 TGTGTGTCTGGAGAAGCCACAGG - Intergenic
1197040461 X:121930133-121930155 CTTTCATCTGGAAAAGCCACAGG + Intergenic
1197366732 X:125572796-125572818 TGTGCACCTGGAAAAGCCACAGG - Intergenic
1197379471 X:125721922-125721944 TATGCACCTGAAAAAGCCACAGG + Intergenic
1197510183 X:127361477-127361499 AGTGCACCTGAAAAAGCCACAGG - Intergenic
1197551961 X:127902216-127902238 TTTGCATCTGGAAAAGCTTCAGG + Intergenic
1197594340 X:128448899-128448921 TGTGCACCTGGAAAGGCTGCAGG - Intergenic
1197611487 X:128644063-128644085 ATTGCACCTGGAAATGGCACTGG - Intergenic
1197640236 X:128959438-128959460 TGTGTGCCTGGAAAAGTCACAGG - Intergenic
1197719215 X:129733543-129733565 CCTGCACCTGGAAAAGCCACAGG + Intergenic
1198304604 X:135368297-135368319 CATGCACCTGGAAAAGCCTCAGG - Intergenic
1198629221 X:138616525-138616547 CATGCACCTGGAAAAGCCACTGG - Intergenic
1198817576 X:140608776-140608798 TGCACACCTGGAAAAGCCACAGG + Intergenic
1198873782 X:141202138-141202160 TGTGCACCTGGAAAAGCCACAGG + Intergenic
1198874016 X:141203819-141203841 ACTGAATCTGGAAAAGCCACAGG - Intergenic
1199077851 X:143544898-143544920 TGTGCACTCAGAAAAGCCACAGG - Intergenic
1199078647 X:143551907-143551929 TGTGAACCTGGAAAAGCCACAGG + Intergenic
1199083753 X:143606205-143606227 TGTGCACTTTGAAGAGCAACAGG + Intergenic
1199119126 X:144029906-144029928 CATGCACATGGAAAAGCCCCAGG + Intergenic
1199189278 X:144951544-144951566 CCTGCTCCTGGAAAAGCCACAGG - Intergenic
1199193336 X:144997588-144997610 TGTACACCTGGAAAAGCTGCAGG + Intergenic
1199220500 X:145310917-145310939 CATGCACCTGGAAAAGCCACAGG - Intergenic
1199223469 X:145343867-145343889 TGTTCACTTGCAAAAGGCACAGG - Intergenic
1199237793 X:145510674-145510696 CCTGTGCCTGGAAAAGCCACAGG + Intergenic
1199258858 X:145747952-145747974 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1199289544 X:146090603-146090625 CCTGTACCTGGAAAAGCCACAGG + Intergenic
1199324081 X:146476657-146476679 TGTGCTCCTGTAGCAGCCACAGG + Intergenic
1199330255 X:146550729-146550751 TGGGCTCCTAGAAAAGCCACAGG - Intergenic
1199375194 X:147099930-147099952 TGTGGATCTAGAAAAGCCACAGG + Intergenic
1199561910 X:149172262-149172284 CATGTGCCTGGAAAAGCCACAGG - Intergenic
1199603358 X:149556763-149556785 TCTGAACCTGGAAAAGCAACCGG + Intergenic
1199638975 X:149841663-149841685 CATGTACCTAGAAAAGCCACAGG - Intergenic
1199647029 X:149922712-149922734 TCTGAACCTGGAAAAGCAACCGG - Intergenic
1199806449 X:151305383-151305405 TGTGAGCCTAGAAAAGCCTCAGG - Intergenic
1199823166 X:151471140-151471162 CGTGCACCTGGAAAAGCTCCAGG - Intergenic
1199869840 X:151888432-151888454 GTTGCACCTTGCAAAGCCACAGG + Intergenic
1199928473 X:152494323-152494345 CATGCATCTAGAAAAGCCACAGG + Intergenic
1199993577 X:153004506-153004528 TCTGCACCAGGAAAAGTTACAGG - Intergenic
1200295325 X:154913826-154913848 CGTGGGCCTGGAAAAGCCACAGG - Intronic
1200356910 X:155561946-155561968 TGTACACCTGGAAAAGCCACAGG - Intronic
1200437196 Y:3165784-3165806 TGTGTGTCTGGAAAAGCCACAGG - Intergenic
1200445960 Y:3260187-3260209 TCTGCACCCTGAAAAGCCATAGG + Intergenic
1200480813 Y:3700728-3700750 TATGCACCTTGAAAAGCTGCAGG + Intergenic
1200497145 Y:3899989-3900011 CATGCACCTGGAAAAGCTGCAGG - Intergenic
1200515768 Y:4142270-4142292 AATGCACCTGGAAAAGACACAGG + Intergenic
1200531584 Y:4346972-4346994 TGTGCACCTGAAAAAGCTGCAGG - Intergenic
1200545854 Y:4517801-4517823 CATGCACCTGGAAAAGCCGCAGG - Intergenic
1200552014 Y:4589979-4590001 CATGCACCTGAAAAAGCCACAGG - Intergenic
1200563326 Y:4734469-4734491 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1200621473 Y:5454379-5454401 TGTGCACCTGGAAAAGCTGCAGG - Intronic
1200718395 Y:6575952-6575974 CATGCACCTGGAAAAGCCACAGG + Intergenic
1201760369 Y:17530499-17530521 CTTGCACCTGGAAAAGCTAGAGG - Intergenic
1201841185 Y:18375491-18375513 CTTGCACCTGGAAAAGCTAGAGG + Intergenic
1202097875 Y:21272641-21272663 CATGCACCTGGACAAGCTACAGG - Intergenic