ID: 1097343589

View in Genome Browser
Species Human (GRCh38)
Location 12:58466989-58467011
Sequence AGCAGTTTGCACTGTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097343589_1097343594 -7 Left 1097343589 12:58466989-58467011 CCAGGTGCACAGTGCAAACTGCT No data
Right 1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG No data
1097343589_1097343593 -10 Left 1097343589 12:58466989-58467011 CCAGGTGCACAGTGCAAACTGCT No data
Right 1097343593 12:58467002-58467024 GCAAACTGCTTGTAGGGGTCTGG No data
1097343589_1097343596 0 Left 1097343589 12:58466989-58467011 CCAGGTGCACAGTGCAAACTGCT No data
Right 1097343596 12:58467012-58467034 TGTAGGGGTCTGGAGGATGGTGG No data
1097343589_1097343599 24 Left 1097343589 12:58466989-58467011 CCAGGTGCACAGTGCAAACTGCT No data
Right 1097343599 12:58467036-58467058 CCTTTTCTCACAGCTCCACCAGG 0: 8
1: 193
2: 1840
3: 2147
4: 1739
1097343589_1097343595 -3 Left 1097343589 12:58466989-58467011 CCAGGTGCACAGTGCAAACTGCT No data
Right 1097343595 12:58467009-58467031 GCTTGTAGGGGTCTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097343589 Original CRISPR AGCAGTTTGCACTGTGCACC TGG (reversed) Intergenic
No off target data available for this crispr