ID: 1097343594

View in Genome Browser
Species Human (GRCh38)
Location 12:58467005-58467027
Sequence AACTGCTTGTAGGGGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097343588_1097343594 5 Left 1097343588 12:58466977-58466999 CCTGTGGCTTTTCCAGGTGCACA 0: 45
1: 94
2: 244
3: 392
4: 729
Right 1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG No data
1097343589_1097343594 -7 Left 1097343589 12:58466989-58467011 CCAGGTGCACAGTGCAAACTGCT No data
Right 1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097343594 Original CRISPR AACTGCTTGTAGGGGTCTGG AGG Intergenic
No off target data available for this crispr