ID: 1097347138

View in Genome Browser
Species Human (GRCh38)
Location 12:58505959-58505981
Sequence CCTCCACCCTGGTGACCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097347129_1097347138 -2 Left 1097347129 12:58505938-58505960 CCCTGCCCCTCTTCTGTCTGGCC No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data
1097347130_1097347138 -3 Left 1097347130 12:58505939-58505961 CCTGCCCCTCTTCTGTCTGGCCT No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data
1097347132_1097347138 -8 Left 1097347132 12:58505944-58505966 CCCTCTTCTGTCTGGCCTCCACC No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data
1097347127_1097347138 4 Left 1097347127 12:58505932-58505954 CCTATGCCCTGCCCCTCTTCTGT No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data
1097347133_1097347138 -9 Left 1097347133 12:58505945-58505967 CCTCTTCTGTCTGGCCTCCACCC No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data
1097347126_1097347138 10 Left 1097347126 12:58505926-58505948 CCATTTCCTATGCCCTGCCCCTC No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data
1097347124_1097347138 16 Left 1097347124 12:58505920-58505942 CCTCCTCCATTTCCTATGCCCTG No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data
1097347131_1097347138 -7 Left 1097347131 12:58505943-58505965 CCCCTCTTCTGTCTGGCCTCCAC No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data
1097347125_1097347138 13 Left 1097347125 12:58505923-58505945 CCTCCATTTCCTATGCCCTGCCC No data
Right 1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097347138 Original CRISPR CCTCCACCCTGGTGACCTTG GGG Intergenic
No off target data available for this crispr