ID: 1097349468

View in Genome Browser
Species Human (GRCh38)
Location 12:58532708-58532730
Sequence ACTTCAGGCGAAACTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097349468_1097349471 -4 Left 1097349468 12:58532708-58532730 CCTCCATCAGTTTCGCCTGAAGT No data
Right 1097349471 12:58532727-58532749 AAGTACAAGAGCCTCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097349468 Original CRISPR ACTTCAGGCGAAACTGATGG AGG (reversed) Intergenic
No off target data available for this crispr