ID: 1097349520

View in Genome Browser
Species Human (GRCh38)
Location 12:58533099-58533121
Sequence CTCTTCATCTACTCTATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097349512_1097349520 8 Left 1097349512 12:58533068-58533090 CCCCCTGGCATGCCCTTTGCTGC No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349508_1097349520 14 Left 1097349508 12:58533062-58533084 CCCCCACCCCCTGGCATGCCCTT No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349516_1097349520 -4 Left 1097349516 12:58533080-58533102 CCCTTTGCTGCCATAACCTCTCT No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349511_1097349520 11 Left 1097349511 12:58533065-58533087 CCACCCCCTGGCATGCCCTTTGC No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349505_1097349520 30 Left 1097349505 12:58533046-58533068 CCCTTGAGATTTTTAACCCCCAC No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349510_1097349520 12 Left 1097349510 12:58533064-58533086 CCCACCCCCTGGCATGCCCTTTG No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349506_1097349520 29 Left 1097349506 12:58533047-58533069 CCTTGAGATTTTTAACCCCCACC No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349517_1097349520 -5 Left 1097349517 12:58533081-58533103 CCTTTGCTGCCATAACCTCTCTT No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349515_1097349520 5 Left 1097349515 12:58533071-58533093 CCTGGCATGCCCTTTGCTGCCAT No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349509_1097349520 13 Left 1097349509 12:58533063-58533085 CCCCACCCCCTGGCATGCCCTTT No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349513_1097349520 7 Left 1097349513 12:58533069-58533091 CCCCTGGCATGCCCTTTGCTGCC No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data
1097349514_1097349520 6 Left 1097349514 12:58533070-58533092 CCCTGGCATGCCCTTTGCTGCCA No data
Right 1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097349520 Original CRISPR CTCTTCATCTACTCTATGTC TGG Intergenic
No off target data available for this crispr