ID: 1097353729

View in Genome Browser
Species Human (GRCh38)
Location 12:58577900-58577922
Sequence ACAAATCCTGTATTTCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097353724_1097353729 3 Left 1097353724 12:58577874-58577896 CCTAGAACTTTAGACTGAAATGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1097353729 12:58577900-58577922 ACAAATCCTGTATTTCATGGGGG 0: 1
1: 0
2: 2
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097353729 Original CRISPR ACAAATCCTGTATTTCATGG GGG Intronic
904453933 1:30635722-30635744 ACAAACCCTGCATTTGCTGGAGG - Intergenic
908066529 1:60412006-60412028 ACAATTGCTGTATTTTATGAAGG - Intergenic
908189054 1:61682369-61682391 AGAAATCCTATATATCATGTAGG - Intronic
908860691 1:68484163-68484185 ATAAAATCTGTATTTCATGAAGG + Intronic
909312179 1:74166249-74166271 TCAAATTATCTATTTCATGGTGG + Intronic
909854346 1:80509239-80509261 ACAAATCCTATACTTCATTGGGG + Intergenic
909997669 1:82300669-82300691 ACTAATCCAGTATTTCCTGCAGG + Intergenic
915078840 1:153337327-153337349 ACAATTCCAGAATTTCATGCTGG - Intronic
918668655 1:187184771-187184793 ACAAAGCCTGTATTTCTTCAGGG + Intergenic
920033733 1:203052233-203052255 ACAAAAGCTGTGGTTCATGGCGG + Intronic
922018989 1:221684931-221684953 ACAGATCTTGTATTTGTTGGAGG + Intergenic
923128815 1:231057164-231057186 ACAAGGCATGTCTTTCATGGAGG + Intergenic
923170930 1:231416351-231416373 ACAAATCCTTAATTACGTGGAGG - Intronic
923308902 1:232715812-232715834 AAAATTCCTGCCTTTCATGGAGG + Intergenic
923570047 1:235105314-235105336 ACACTTACTGTATTTCATGGTGG + Intergenic
923713627 1:236406635-236406657 ACAGATCATGTATATGATGGTGG - Intronic
924445085 1:244122219-244122241 ACAACTCCTGTTTTTCAGTGAGG + Intergenic
924464678 1:244289561-244289583 AAAAATACTGTATATTATGGAGG + Intergenic
924825840 1:247537891-247537913 GCAAATCATGTATTTCATAAGGG - Intronic
1062856656 10:783263-783285 AGGAATCCTGTATTTCCTGGTGG - Intergenic
1063901152 10:10733642-10733664 GAAAATCCTGTCTTGCATGGTGG + Intergenic
1064547460 10:16465078-16465100 ACAATTCCCATATGTCATGGAGG - Intronic
1067126530 10:43521167-43521189 ACTAACCCTGTATTTCATCTGGG - Intergenic
1072327959 10:94316825-94316847 AGAAATTCTGAATTTCAGGGAGG - Intronic
1073344188 10:102769779-102769801 TCAAATCATGTATTTCAGAGAGG - Intronic
1073656177 10:105419601-105419623 ACAAATCCTTTATTCCATGTAGG + Intergenic
1075637736 10:124041474-124041496 ATTAATCCTGTATTGCATGCTGG + Intronic
1078255994 11:9659270-9659292 ATAAAGCCTGTATTCCATAGTGG - Intergenic
1081053148 11:38372066-38372088 AACAATCCTGTAATTCATGTGGG + Intergenic
1084944047 11:72629410-72629432 ACAAATCCAGTCTTTCCTGGCGG + Intronic
1085487525 11:76879580-76879602 AGATATCCTGTATTTGATTGAGG + Intronic
1085868463 11:80322915-80322937 ACAAAACCTGTATCTCAAGTCGG + Intergenic
1087530829 11:99380042-99380064 ACAAATCCCGTATACAATGGTGG + Intronic
1090528391 11:127562465-127562487 ACAAATCCAGTATTTCTTGGAGG + Intergenic
1091569689 12:1673792-1673814 ACAAATCATGTATTTAATAAGGG - Intergenic
1097132989 12:56827261-56827283 AGAAATGCAGTATTACATGGAGG + Intergenic
1097353729 12:58577900-58577922 ACAAATCCTGTATTTCATGGGGG + Intronic
1098600524 12:72326195-72326217 ACAAATCCTATATTTCATTCTGG + Intronic
1098828164 12:75325988-75326010 ATATATCTTCTATTTCATGGTGG - Intronic
1098896555 12:76069423-76069445 AGAAATGCTGTATTTCTTTGAGG + Intronic
1099522232 12:83679108-83679130 ACAAATACTGAATTTCATGCAGG + Intergenic
1101611124 12:106292960-106292982 ACATATCCTGTAATTATTGGAGG - Intronic
1107606528 13:42062961-42062983 AAAAATCTGGTATTTCTTGGTGG + Intronic
1108948018 13:56046644-56046666 ACAAGCCCTGTATTTAAAGGTGG + Intergenic
1109363376 13:61325054-61325076 ACAAATCCCATATTTCTTGGAGG - Intergenic
1110008682 13:70305035-70305057 ACAAGTCATGTCTTACATGGTGG - Intergenic
1111809459 13:93080665-93080687 ACAAATCATGTATATCAGGTTGG + Intergenic
1113415317 13:110124381-110124403 ATAAACCCTGAATTTCCTGGGGG - Intergenic
1113496854 13:110737739-110737761 ACCAAGCATGTATTACATGGTGG - Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1115117131 14:29894700-29894722 ACAAAACTTGGATTACATGGTGG + Intronic
1116124419 14:40764776-40764798 ACAACAATTGTATTTCATGGTGG + Intergenic
1118464595 14:66019523-66019545 ACAGATCCTGTACCTCAGGGCGG - Intergenic
1119996786 14:79262128-79262150 ACTAATCCTGTCTTTCATACTGG - Intronic
1120655074 14:87179677-87179699 AAAATTCCTCTTTTTCATGGTGG - Intergenic
1121553289 14:94818621-94818643 ACAGATCCTGTAATACCTGGAGG - Intergenic
1124805680 15:32879829-32879851 ACAAATGCTTTGTTTCATTGTGG + Intronic
1125343768 15:38698733-38698755 ACAGATCCTGTAACCCATGGTGG + Exonic
1126083826 15:44991587-44991609 ACAAGTCCCATATTTCTTGGAGG - Intergenic
1127545662 15:59992928-59992950 AGAAATCATGTATATCATGTGGG + Intergenic
1129575573 15:76740339-76740361 ACATTTCCTGTATTTTATGTTGG - Intronic
1130038837 15:80386697-80386719 ATAAAACCTGCATTTCATTGCGG - Intronic
1131953535 15:97706664-97706686 ACAAAAATTGTATTGCATGGTGG + Intergenic
1138149517 16:54643122-54643144 AAAAATCCTTTATTTAATGGGGG - Intergenic
1142932453 17:3298628-3298650 TCAAATCTCTTATTTCATGGAGG - Intergenic
1150133874 17:62684170-62684192 TCAAAACATGCATTTCATGGTGG + Intronic
1151326261 17:73381294-73381316 ACGACTCCAGTATTTCATGCTGG - Intronic
1155603100 18:27572098-27572120 AGAAATTATGTGTTTCATGGAGG + Intergenic
1156068443 18:33174623-33174645 ACAAATCCTTTATTTTAAGAAGG + Intronic
1162128362 19:8511345-8511367 AAAAATCCTGTATTTCGGGACGG + Intronic
1162673915 19:12284072-12284094 ACGAATCCTTTTTTACATGGAGG - Intronic
1163689752 19:18732059-18732081 ACAGTTCCTGTAATTCCTGGGGG + Intronic
1167328433 19:48838918-48838940 ACAAATCCCGTAATGCATGTGGG - Intronic
925415388 2:3666763-3666785 TCAAATTCTGCATTGCATGGTGG + Intronic
929933256 2:46274920-46274942 ACGAGTCCTTAATTTCATGGAGG + Intergenic
931137076 2:59414799-59414821 ACAAATCATGTATCTGATGAAGG + Intergenic
931886562 2:66624650-66624672 ACAAGTCCTATATTTCTTGGAGG + Intergenic
932230198 2:70077358-70077380 ACTTATCCTGTATTACATGAAGG - Intergenic
933325218 2:80827087-80827109 CCAAAACCTTTGTTTCATGGGGG + Intergenic
935094763 2:99933987-99934009 CCAAAGCCTGTAATGCATGGTGG - Intronic
937572589 2:123382007-123382029 CAAAATCCTGTACTTCTTGGAGG - Intergenic
941932533 2:170956472-170956494 TCAATTCCTGTAGTTCCTGGTGG - Exonic
942687179 2:178545603-178545625 ACAAAACCTGAATCTGATGGTGG - Exonic
943036671 2:182755083-182755105 ACAAATCTTGGAGTTCATAGAGG + Exonic
943748711 2:191488854-191488876 ACAAATCATATATTTTATAGGGG - Intergenic
945045622 2:205779008-205779030 CAAAATTCTGTATTTCATGGAGG + Intronic
946052137 2:216872011-216872033 ACAATTCCTGGACTTCATGATGG - Intergenic
946998099 2:225419186-225419208 ACAAATCCTGTAATACAAGAAGG + Intronic
1168912343 20:1459090-1459112 AAAAATTCTGTATTTCTTAGGGG + Intronic
1170411095 20:16092860-16092882 AGAAAAACTGTATTTCATAGGGG + Intergenic
1170521516 20:17190550-17190572 ACAATTCCTGTCTTTGATGCTGG - Intergenic
1175231826 20:57478507-57478529 ACAATTCATTTATTTGATGGGGG - Intergenic
1175954294 20:62600682-62600704 ACAAATCATCTTTTTGATGGTGG - Intergenic
1177127009 21:17206703-17206725 ACAAATCATGTATCTGATAGGGG + Intergenic
1177920570 21:27147185-27147207 AAAAATCCTATACTTCTTGGTGG + Intergenic
1178562200 21:33649004-33649026 TCTAATCCTGTTTTTCATGCAGG - Intronic
1178828609 21:36035888-36035910 AGAAATCCTGCATGTCCTGGGGG + Exonic
1178943234 21:36925067-36925089 ACAAAACCTGCTTTTTATGGGGG + Intronic
1179060132 21:37972142-37972164 ACAAAGCAGGTATTTAATGGAGG - Intronic
1183488159 22:38101017-38101039 ATAAATCCTGTTTAACATGGTGG + Intronic
1184435550 22:44472696-44472718 AAAAACCCTGTATTTCATTAAGG + Intergenic
949694146 3:6674843-6674865 ACATCTCCTGTATTTCATAGAGG + Intergenic
950938212 3:16865367-16865389 AAAAATGCTATATTTTATGGGGG - Intronic
951526030 3:23653887-23653909 ACAAATGCTGTCTTTAAAGGAGG + Intergenic
954889496 3:53911757-53911779 GCAAATCATGTATTTGATGAGGG + Intergenic
956202589 3:66721738-66721760 ATAAATAATGAATTTCATGGAGG + Intergenic
957669882 3:83287705-83287727 ACAGATTCTGTGTTTCATAGAGG - Intergenic
957854763 3:85860287-85860309 AAAAATCCTGTATTACATGGAGG + Intronic
957865286 3:86015026-86015048 ACACAACCTGGATTTAATGGCGG + Intronic
958157622 3:89774577-89774599 ACACATACTGTTTTTCAAGGTGG + Intergenic
959205696 3:103303850-103303872 TGAAATCCCGTATTTCTTGGAGG + Intergenic
961028138 3:123579059-123579081 ACAAATCCTGGATTTGATTTTGG - Intronic
962212820 3:133493124-133493146 ACATAACCTGTATTTCTCGGAGG - Intergenic
965337286 3:167442426-167442448 ATTAATCCTGTTTTTCATAGAGG + Intronic
970188748 4:13489880-13489902 GCAAATATTGTATTTTATGGGGG + Intergenic
970913358 4:21305072-21305094 TTAAATTCTGTATTTCATTGTGG - Intronic
971301738 4:25447650-25447672 ACAAATTATGTATGGCATGGTGG - Intergenic
973592908 4:52460429-52460451 ACTAGTCCCATATTTCATGGAGG - Intergenic
973798548 4:54452661-54452683 ACATATCCCATATTTCTTGGAGG - Intergenic
973828993 4:54739043-54739065 AGAAATCTAGTATTTCATGCTGG + Exonic
975261165 4:72301372-72301394 GCAAATCATGTATTTCACAGAGG + Intronic
976558136 4:86473240-86473262 ACAAATACTGTATTTCTAGTTGG + Intronic
977680165 4:99789959-99789981 ACTAATCCTGTCTTTTTTGGAGG + Intergenic
979076404 4:116276136-116276158 TATAATCCTGTATTTCTTGGAGG - Intergenic
979156449 4:117397350-117397372 ACCCATACTGTATTTAATGGAGG + Intergenic
979194282 4:117901385-117901407 ACAATTCCTGTATGTTATTGTGG - Intergenic
979294099 4:119011135-119011157 CCAAATCCTGTACTTCAAGAAGG - Intronic
979919561 4:126479976-126479998 ACAAAAAAGGTATTTCATGGCGG - Intergenic
979949674 4:126876337-126876359 ACAAATACCGTTTTTCATGTTGG - Intergenic
980509480 4:133766569-133766591 CCATATCCTAAATTTCATGGGGG + Intergenic
980787254 4:137571749-137571771 TCTAGTCCTGTATTTCTTGGAGG + Intergenic
981365159 4:143893974-143893996 ACATATCCCATATTTCTTGGAGG + Intronic
981470289 4:145126184-145126206 ACAAATACTGTATTTCACAGAGG - Intronic
982526447 4:156484978-156485000 ATAAATCCTGTCTCTCAAGGTGG + Intergenic
984222572 4:176995607-176995629 CCAAATCCTGTATTTCAGATAGG + Intergenic
985235513 4:187869406-187869428 ACAATTACTGTATTTCCTGTTGG - Intergenic
986173048 5:5329066-5329088 ACAATTCCTATGTGTCATGGGGG - Intergenic
986492661 5:8308150-8308172 ACAAACCCTGTGTTTAAAGGTGG + Intergenic
986944602 5:13000652-13000674 ACAGATCTTGTAATTAATGGTGG + Intergenic
987991426 5:25217553-25217575 GCAAGTCATGTATTACATGGAGG + Intergenic
988394859 5:30683759-30683781 ACAAATCATGTATTTGATAAGGG + Intergenic
988395878 5:30697625-30697647 ACACATTCTGTTTTACATGGTGG - Intergenic
990156799 5:52887031-52887053 AAAAACCCTGAATTTCAGGGAGG - Intronic
991290146 5:65025656-65025678 AGAAATCCTTTCCTTCATGGAGG - Intergenic
992607489 5:78473961-78473983 ACAAATTCAGTATCTCAGGGGGG + Intronic
992989374 5:82268579-82268601 ACATATCCAGTATTACCTGGTGG + Intronic
994300020 5:98136313-98136335 ACTAGTCCTATATTTCTTGGAGG - Intergenic
994704472 5:103184335-103184357 ACAGCTCCTGTATTTGAAGGGGG - Intronic
996195765 5:120605210-120605232 GATAATCCTGTATTTCTTGGAGG + Intronic
996306341 5:122052409-122052431 CAAAATCCTATATTTCTTGGAGG + Intronic
996546437 5:124683760-124683782 ATAAATTCTGTATTTCACAGTGG + Intronic
998749517 5:145303779-145303801 ACAAATCCTCCATTTCATGATGG + Intergenic
999465936 5:151804496-151804518 TCAAATCCTGTATTTCTTACAGG - Exonic
1000529644 5:162403448-162403470 ACAAAACATGTATTTAATGTAGG - Intergenic
1000685313 5:164241757-164241779 TAAAATCCTGTATTTTATCGGGG + Intergenic
1000904935 5:166953863-166953885 ACAATTCCTGTACATCAAGGAGG + Intergenic
1001017951 5:168158473-168158495 CCAAATCTTGGATCTCATGGGGG + Intronic
1004964837 6:20836701-20836723 ATACATCTTGTATTTAATGGGGG + Intronic
1009864246 6:69376538-69376560 ACAAATCCCCATTTTCATGGGGG + Intronic
1010340436 6:74744694-74744716 ACAAATCCTTTATTTAAGGATGG + Intergenic
1010465411 6:76162461-76162483 ACAAATCCTGTATTTGAAGCTGG - Intergenic
1010917707 6:81641355-81641377 AAAAATCCAGAATTTCATTGTGG + Intronic
1011935532 6:92771860-92771882 ACAAATCCTTCTTTACATGGTGG + Intergenic
1013627023 6:111948803-111948825 TCAAATCCTGGTTTTCTTGGGGG + Intergenic
1015500914 6:133932172-133932194 CGTAATCCTGTATTTCTTGGAGG - Intergenic
1017556574 6:155577987-155578009 AGTATTACTGTATTTCATGGAGG + Intergenic
1018344391 6:162885657-162885679 ACCAACCCTGTATTTCCTTGAGG + Intronic
1018406930 6:163495301-163495323 ACCAACCCTGTATTTCCTTGAGG + Intronic
1018529611 6:164748968-164748990 GCTAATGATGTATTTCATGGAGG - Intergenic
1018862129 6:167718799-167718821 GCAAGTCCTGTCTTACATGGAGG - Intergenic
1022701649 7:32766508-32766530 ACAAAGGATGTATTTCATGTTGG - Intergenic
1024582988 7:50815240-50815262 ACAATTACTATATGTCATGGAGG + Intergenic
1027972236 7:85099373-85099395 AAAAGTCCTGTCTTACATGGTGG - Intronic
1028965944 7:96801317-96801339 ACAACTCCTGAAGTTCATTGAGG - Intergenic
1029328687 7:99832778-99832800 GCAAAGCATGTATTACATGGAGG - Intronic
1030098017 7:105918602-105918624 GCAAATCCTGTATCTCAAGAGGG - Intronic
1032160733 7:129507909-129507931 ACAAATCATGTATCTCATAAAGG - Intronic
1032988377 7:137363486-137363508 ACAAAACATATATTTCAGGGTGG + Intergenic
1033761077 7:144437397-144437419 ATAAATCCTATATTGCATGTTGG - Intergenic
1034240250 7:149604972-149604994 ACAAATCTTAAAATTCATGGAGG + Intergenic
1037113807 8:15199371-15199393 ATAAATTCTGTATTTAATGGGGG - Intronic
1037231864 8:16668861-16668883 ATAATTCATGTATTTCTTGGTGG - Intergenic
1038679602 8:29654463-29654485 AAAAATGCTGTTTTTCATGAAGG - Intergenic
1038706871 8:29902522-29902544 TGAAGTCCTGTATTTCTTGGAGG - Intergenic
1042752296 8:72170988-72171010 ATAAATCCTGTTTTTTATGCTGG - Intergenic
1042764822 8:72309265-72309287 ATAAATCCTGTTTTTTATGCTGG - Intergenic
1046101384 8:109617767-109617789 AGAAATCCTCTATTTCCTAGTGG - Intronic
1047654945 8:126966915-126966937 ACAAATTCTGTTTTTTCTGGGGG + Intergenic
1047755913 8:127918238-127918260 ACAAGTCCTGACTTTCCTGGTGG + Intergenic
1048693972 8:137002984-137003006 ACAAAACCTATAGTCCATGGAGG + Intergenic
1052269242 9:26609113-26609135 ACAAATGCTGTCTTTCTGGGGGG - Intergenic
1057845853 9:98521960-98521982 ACCCATTTTGTATTTCATGGAGG + Intronic
1059241735 9:112811899-112811921 TTAGATCCTGAATTTCATGGAGG + Intronic
1186348498 X:8719073-8719095 ACAAATCCAGTATGCCAAGGAGG - Intronic
1187008841 X:15259325-15259347 CCAAAGTCTGTATTTCATGCAGG - Intronic
1192030481 X:67507269-67507291 AAAAAACGTGTATCTCATGGAGG + Intergenic
1193052153 X:77112843-77112865 CATAATCCTGTATTTCTTGGAGG - Intergenic
1193109999 X:77719189-77719211 TCAAATCCTGTATCTCATGAGGG + Intronic
1193347220 X:80417971-80417993 CATAATCCTGTATTTCTTGGAGG + Intronic
1194850091 X:98858894-98858916 AAAAGTCATGTTTTTCATGGTGG - Intergenic
1196624947 X:117867838-117867860 ACATATCCTCTATTTTATGATGG - Intergenic
1197076694 X:122362403-122362425 ACAAATCCCGTATTTCTCAGAGG + Intergenic
1199865541 X:151846255-151846277 ACAAATCATATATTTGATGCAGG + Intergenic