ID: 1097356632

View in Genome Browser
Species Human (GRCh38)
Location 12:58609437-58609459
Sequence CAGGTTGTTACTGCTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097356624_1097356632 13 Left 1097356624 12:58609401-58609423 CCCATGGGTGGATGTAAGTGGCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1097356632 12:58609437-58609459 CAGGTTGTTACTGCTTTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 162
1097356625_1097356632 12 Left 1097356625 12:58609402-58609424 CCATGGGTGGATGTAAGTGGCAA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1097356632 12:58609437-58609459 CAGGTTGTTACTGCTTTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097356632 Original CRISPR CAGGTTGTTACTGCTTTTGG GGG Intronic
900653700 1:3744639-3744661 CAGGTTGTTAACGCATGTGGAGG - Intergenic
902164280 1:14557106-14557128 CACGTTATTTCTGCTTTTGTTGG - Intergenic
902796108 1:18801236-18801258 AATGTTATTACTGGTTTTGGTGG - Intergenic
903614401 1:24641726-24641748 CAGGTGGTTTGTGGTTTTGGTGG + Intronic
904240183 1:29139163-29139185 CAGGTTGTTTTTGGTTTTGGTGG + Intergenic
904995168 1:34626008-34626030 CAGTTTGTCTCTGCTTTTTGTGG - Intergenic
905029905 1:34875111-34875133 CAGCTTCTTATTGCTTTTGCAGG + Intronic
907984494 1:59517197-59517219 CAGGTTGTTATTGCCTTTCAGGG - Intronic
908574310 1:65442753-65442775 CAGGTTGGTTTTGTTTTTGGAGG - Intronic
915059169 1:153165899-153165921 AAGGCTGTCACTGCTATTGGTGG - Intergenic
915586256 1:156845484-156845506 CGGGTTGTGGGTGCTTTTGGAGG - Intronic
920415766 1:205798419-205798441 CAGATTCTTACTTCTCTTGGAGG - Intronic
922033585 1:221826980-221827002 CAGGATGCCACTGCTGTTGGGGG + Intergenic
1064335198 10:14434066-14434088 CAGGCTGTTACCACTTGTGGTGG - Intronic
1067140678 10:43653781-43653803 CAGGCTGCTTCTGCTCTTGGCGG + Intergenic
1067765760 10:49084965-49084987 TTGGTTGTCACAGCTTTTGGGGG - Intronic
1070152355 10:73812478-73812500 CATTGTGTTACTGCTGTTGGAGG - Intergenic
1073151071 10:101311763-101311785 CAGGTTGGTAGTGGTTCTGGCGG + Intergenic
1075169272 10:120098038-120098060 AATGTTTTTACTTCTTTTGGTGG + Intergenic
1079466107 11:20732523-20732545 CAGGTGGTGAGTGCTGTTGGAGG + Intronic
1081093418 11:38900938-38900960 CAGTTTGTTACTGCTTGCTGGGG - Intergenic
1081318940 11:41666995-41667017 CTGTTTGTTACTGCTTGTTGTGG - Intergenic
1083753358 11:64775552-64775574 CAGCATGTTACTACTTTTGAGGG - Intronic
1087808717 11:102585994-102586016 TAGGTTGTTGGTGTTTTTGGAGG + Intronic
1087869498 11:103274714-103274736 TTGGTTGTAACTGTTTTTGGGGG + Intronic
1088822230 11:113466227-113466249 CAAACTGTTACTGCGTTTGGAGG + Intronic
1091545916 12:1501146-1501168 CAGATTGTTTCTGCTTGAGGAGG + Intergenic
1093639825 12:21513337-21513359 AAGGTTGTAACATCTTTTGGTGG + Intronic
1093781039 12:23137745-23137767 AAGGTTGTTGCTGATCTTGGAGG + Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1097356632 12:58609437-58609459 CAGGTTGTTACTGCTTTTGGGGG + Intronic
1097964135 12:65561047-65561069 CCAGTTGTTACTTTTTTTGGTGG + Intergenic
1099023045 12:77430413-77430435 CAGATTGTTAATGCTTTTGAAGG - Intergenic
1099296153 12:80830509-80830531 AATGTTGTTACTACATTTGGGGG + Intronic
1100705282 12:97194071-97194093 CAGTTTGGTTCTTCTTTTGGGGG + Intergenic
1105827282 13:24133873-24133895 CAGGCTGTCACTTCTTCTGGAGG - Intronic
1106574567 13:30962565-30962587 CTGGTTCTTACTTCTTTTGTAGG + Intronic
1107029300 13:35834605-35834627 GAGGTTGCTCCTGCTTTGGGAGG + Intronic
1107307261 13:39036616-39036638 CAAGTTTTTGCTGCTTTTTGAGG - Intronic
1108273470 13:48785174-48785196 CTGGTGTTTTCTGCTTTTGGGGG + Intergenic
1110531932 13:76607873-76607895 CATTTTATCACTGCTTTTGGAGG - Intergenic
1114713181 14:24799055-24799077 CAGGCTGTTTCTGCTAGTGGTGG + Intergenic
1118075819 14:62297685-62297707 CAGGTTATTTCTCCTTTAGGAGG - Intergenic
1121739267 14:96240118-96240140 GAGATTGTTAGTGCTGTTGGTGG + Intronic
1129354231 15:74978598-74978620 AAAGTTGTTTCTGCTTGTGGAGG + Intronic
1131228659 15:90645331-90645353 GAGGTTGTCTCTGCATTTGGTGG + Intronic
1131981504 15:97999101-97999123 CAGATTGTGACTGTGTTTGGAGG + Intergenic
1133698517 16:8287662-8287684 CAGTTTGGCCCTGCTTTTGGTGG + Intergenic
1135586075 16:23672077-23672099 CAGGTTCTTACTGCTCCTGTGGG - Exonic
1137798450 16:51241183-51241205 CAGGCTGTTTCTGCTCATGGTGG + Intergenic
1138718747 16:59053981-59054003 TAGGCTTTTATTGCTTTTGGTGG - Intergenic
1140741991 16:77949691-77949713 CAGGCTGTTTCTGCTCATGGCGG - Intronic
1141891229 16:86928022-86928044 CAGGGGGATACTGCTTATGGGGG + Intergenic
1142500327 17:328629-328651 TTCGTTGTTTCTGCTTTTGGCGG - Intronic
1144000252 17:11047565-11047587 TGGGGTGTTACTGCTTTTGCAGG + Intergenic
1144205831 17:12978988-12979010 CAGGTTGTGCCTGCTCTTGTGGG + Intronic
1148070092 17:44903692-44903714 CAGATTGTTGCTGCTTTTCCTGG + Exonic
1149416317 17:56463650-56463672 CAGATTTTTACTGTTTTGGGGGG - Intronic
1151530062 17:74698414-74698436 CATATTGCTGCTGCTTTTGGTGG - Exonic
1151530907 17:74704094-74704116 CAGGTGTGTCCTGCTTTTGGTGG - Intronic
1152064932 17:78106148-78106170 TGGGTTGTGACTGCTTTTGGGGG + Exonic
1152199652 17:78937987-78938009 CAGGGTCTGACAGCTTTTGGCGG - Intergenic
1152979424 18:261921-261943 CAGGTTGTGAAAGCTCTTGGGGG - Intronic
1157631070 18:49096439-49096461 AGTGTTGTTACTGTTTTTGGGGG - Intronic
1160991332 19:1861517-1861539 CAGGGTGTTACCTCTTTTTGAGG - Intronic
1161676478 19:5653200-5653222 CAGGTGGTTAATGCATTTTGTGG - Exonic
1162587789 19:11571595-11571617 CAGGATTTTATTGGTTTTGGGGG - Intronic
927895797 2:26780931-26780953 CAGGTTATTACAGCTTGTGGGGG + Exonic
927944746 2:27128932-27128954 GAGGATGTCACTGGTTTTGGAGG - Exonic
928052334 2:28012151-28012173 CAGCTTGTTACTGTTTTTCCTGG - Intronic
930148855 2:48036898-48036920 CAGGTTTATACTGCTTCTGGAGG + Intergenic
932077993 2:68683782-68683804 GATTTTGTTACTGCTATTGGTGG - Intronic
936350080 2:111706001-111706023 CAGGTGGCTGATGCTTTTGGTGG - Intergenic
939631612 2:144532815-144532837 CAGGTAGTTACTGCTTGTCATGG + Intergenic
942025019 2:171902007-171902029 CAGGTTGTTCTTCCTTTTGAAGG - Intronic
943065864 2:183085491-183085513 GAGGTTGTTAGTGCGTTTGGTGG + Intronic
943218709 2:185075844-185075866 AGTGTTGTTTCTGCTTTTGGGGG - Intergenic
944453259 2:199866067-199866089 CAGGTTTTTAATGATCTTGGGGG - Intergenic
945967611 2:216205635-216205657 CAAGTTGTGACAGCTGTTGGAGG - Exonic
946445659 2:219738037-219738059 CAAGTTGTCCCAGCTTTTGGGGG + Intergenic
1168864054 20:1069489-1069511 CAGGGTAATATTGCTTTTGGAGG - Intergenic
1169344520 20:4819962-4819984 CAGGTTGATGCTGCTGTTTGCGG - Intronic
1171008437 20:21491410-21491432 CTAGTTGTTACTGCTTTTCTTGG - Intergenic
1172795548 20:37534787-37534809 TAGGTTGTGACTTATTTTGGAGG - Intergenic
1173883698 20:46438579-46438601 CAGGTTCTTACTGGCTTTAGAGG + Intergenic
1174446722 20:50595702-50595724 CAGGTTGGTCCTCCTTCTGGGGG - Intronic
1174452654 20:50629482-50629504 AAGGTTGTTTCTGCTTCTGGAGG - Intronic
1174831722 20:53819799-53819821 TAGGTTGTGTCTGCTTTAGGGGG + Intergenic
1177319843 21:19507813-19507835 TAGGTTTTTAATGTTTTTGGTGG + Intergenic
1178353202 21:31887877-31887899 CAGGTTTTTACTGATTTGGAAGG - Intronic
1180905467 22:19407852-19407874 CAAGTTGTGAGTGCTCTTGGAGG - Intronic
950225383 3:11229295-11229317 CAGGTTCTTTCAGTTTTTGGGGG - Intronic
951308318 3:21094386-21094408 ACAGTTGTTAGTGCTTTTGGGGG - Intergenic
952805034 3:37341524-37341546 CTGGTTTTTACTTCTTTTTGAGG - Intronic
953142338 3:40240690-40240712 TAGGTTGTTTCTGCCTTTAGGGG - Intronic
953166023 3:40465629-40465651 CAGGTTGTAATTCCTTATGGAGG + Intergenic
953536001 3:43777229-43777251 CCTGTCATTACTGCTTTTGGAGG + Intergenic
955844436 3:63146874-63146896 CAGCTTGTCACTGCTTTATGTGG + Intergenic
956137833 3:66116602-66116624 CTGGTGGCTTCTGCTTTTGGGGG - Intergenic
958679597 3:97310584-97310606 TTGGTTGTTACTGCTAGTGGTGG + Intronic
959404340 3:105941851-105941873 CAGGTTGTTATTGATTTAAGAGG - Intergenic
959414144 3:106062721-106062743 TAAGCTGTTTCTGCTTTTGGAGG - Intergenic
959579200 3:107967005-107967027 CAGGTTTTTACTTCCTTAGGAGG - Intergenic
960038584 3:113126604-113126626 CAGGCACTTCCTGCTTTTGGTGG + Intergenic
961076888 3:123991092-123991114 CAGGTTGATTCTTCCTTTGGAGG + Intronic
961307694 3:125970218-125970240 CAGGTTGATTCTTCCTTTGGAGG - Intronic
962698074 3:137970618-137970640 CAGCCTGATACTGCTTTTGTAGG - Intergenic
962769787 3:138601585-138601607 CAGGCTGATCCTGCTTTTGAAGG - Intergenic
969998836 4:11343415-11343437 CAGCTTTTTTCTCCTTTTGGGGG - Intergenic
970725339 4:19037230-19037252 CAGAATGTTACTGCATTTGTAGG + Intergenic
972889876 4:43543977-43543999 CAAGTCCTTACTGCTCTTGGTGG - Intergenic
975025073 4:69537918-69537940 CAGGCTGCTATTGCTTTTGATGG + Intergenic
976370410 4:84281456-84281478 CAGTTTGTCACTGTTCTTGGGGG + Intergenic
976839114 4:89410534-89410556 CAGGTTGAAACTGCTTTTAAGGG + Intergenic
977238390 4:94536507-94536529 CATATTGTTTCTGCTTTTGAAGG - Intronic
977324320 4:95555394-95555416 CATGTTGTAACTGCTATTAGAGG + Intergenic
979964183 4:127057578-127057600 AAGGAAGTTAATGCTTTTGGGGG + Intergenic
981043425 4:140244081-140244103 CAGGTTGTTATTGGTGGTGGTGG - Intergenic
984054348 4:174908641-174908663 TAGGCTGTGACTGCTTTTGGAGG + Intronic
984326810 4:178265364-178265386 AAGGCTTTTACTGCTTTTTGTGG - Intergenic
988863389 5:35308182-35308204 CAGGTTGTTAATACTTTGGATGG + Intergenic
989543818 5:42648865-42648887 CAGGTTGTCACAGCTTGTTGAGG - Intronic
993902749 5:93595707-93595729 GAGCTTGTTAATGCATTTGGTGG - Intergenic
995089406 5:108155183-108155205 CAGGTTCTTACAGCTGTTTGTGG + Intronic
998663804 5:144272499-144272521 AAGGTTGTTTTGGCTTTTGGGGG - Intronic
999884575 5:155906997-155907019 CAGGTTGATTCTCTTTTTGGAGG + Intronic
1002831990 6:830753-830775 CTGGGTGTTACTGCTTCTCGTGG - Intergenic
1003363008 6:5446510-5446532 GAGGTGGTTTCTGCCTTTGGGGG + Intronic
1009192541 6:60646711-60646733 CATGTTGTTACTGCATGTGGAGG - Intergenic
1009301799 6:62032667-62032689 TAAGTTGTTTCTGCTTTTGTGGG - Intronic
1010065559 6:71678952-71678974 TTGGTTGTTGCTGCTGTTGGTGG + Intergenic
1011381313 6:86744772-86744794 CAGGCTGTTTCTGCTCATGGTGG - Intergenic
1012298463 6:97554215-97554237 CAGATTTTTCCTTCTTTTGGTGG - Intergenic
1012395813 6:98795951-98795973 CAAGTTGTTATTGCTTGAGGAGG + Intergenic
1016533587 6:145086281-145086303 CAGGTTGGTTCTGCTCATGGAGG + Intergenic
1017684105 6:156894663-156894685 CAGTTTGTTCCTCCTTTTGGAGG - Intronic
1017701757 6:157080672-157080694 AAGATTGTTATTGCTTTGGGTGG + Intronic
1017713689 6:157192200-157192222 CATTTCGTTAGTGCTTTTGGTGG + Intronic
1019575378 7:1735236-1735258 TAGGGTGTTCCTGCTCTTGGGGG + Intronic
1020207095 7:6126733-6126755 CGGGTTGTTTCTGGTTTTGGGGG + Intronic
1020827136 7:13043179-13043201 CAGGTTTTCACTAGTTTTGGGGG + Intergenic
1022817484 7:33927696-33927718 CAGGTTGGTAGGGATTTTGGAGG - Intronic
1023614375 7:42005181-42005203 CTGGTTTTAACTGCTTTTGAAGG + Intronic
1024678508 7:51659569-51659591 GAGGCTGTTACTGCTGCTGGTGG + Intergenic
1026458118 7:70590422-70590444 GAGGTTGTTAGAACTTTTGGGGG + Intronic
1028482234 7:91320135-91320157 CAGATTTTTATTTCTTTTGGGGG + Intergenic
1030261597 7:107570618-107570640 CACCTTGTTACAGCCTTTGGAGG + Intronic
1030923550 7:115422185-115422207 CATATTGTAACTGCATTTGGAGG + Intergenic
1031399271 7:121312454-121312476 CAGGTTATGACTGCTTGTGATGG - Intergenic
1031824014 7:126540519-126540541 TGGGTTGTTTCTGGTTTTGGGGG - Intronic
1037025594 8:14032374-14032396 TAGGTTGTTTCTGGTTTTAGAGG - Intergenic
1037516572 8:19637721-19637743 CAGTTTGTCACTGCTGTTGCAGG + Intronic
1038315509 8:26481294-26481316 AAGGTTGCTACTGTTTTTGGTGG - Intronic
1040127021 8:43749163-43749185 CAGGTTGGTAATGCTTTTTTTGG + Intergenic
1040396755 8:47007889-47007911 CAGGTTGTTAATGCTTGTGAAGG - Intergenic
1043670761 8:82881550-82881572 CAGGTTGTCACTGCTTCCTGGGG - Intergenic
1045134601 8:99201421-99201443 AAATTTGTTATTGCTTTTGGTGG - Intronic
1046175167 8:110566265-110566287 CAAGTTCATACTTCTTTTGGGGG + Intergenic
1046212111 8:111089664-111089686 CTGGTTGATGCGGCTTTTGGTGG - Intergenic
1047869613 8:129068210-129068232 CAGGTTGTTGGTCCTTCTGGAGG + Intergenic
1049148241 8:141017635-141017657 CAGAGTGTTACTGTCTTTGGGGG - Intergenic
1050368409 9:4895587-4895609 CAAGTTGTTACTCTTTTTGAAGG + Intergenic
1051520940 9:17987295-17987317 CACGTTGTAATTACTTTTGGAGG + Intergenic
1053431904 9:38047638-38047660 CAGGTTGCTCTTGCTTTTGGAGG + Intronic
1057015896 9:91651489-91651511 CAGATAGTTACTGCTTTTTCTGG - Intronic
1057515662 9:95718296-95718318 CAGGTTGCCACTGCTTTATGGGG + Intergenic
1057526161 9:95803751-95803773 GAGGTGGTTACTGCCTTTAGTGG + Intergenic
1057743036 9:97728689-97728711 CAGTTTGTACCAGCTTTTGGAGG + Intergenic
1057866682 9:98687141-98687163 CAGGATGTTACTGCAACTGGGGG + Intronic
1058369371 9:104247313-104247335 TAGGTTGTTTCTGTTTTGGGAGG - Intergenic
1061038065 9:128124449-128124471 CAGGTGGCCATTGCTTTTGGTGG - Intronic
1186000074 X:4999798-4999820 AACGTTGTTAATGATTTTGGTGG + Intergenic
1198135505 X:133745734-133745756 CAAGTTCTCAATGCTTTTGGAGG - Intronic
1198316338 X:135470396-135470418 CTTGTTGTTACTGCTTATTGTGG - Intergenic
1198928739 X:141828913-141828935 GAGGTTGTGACTGCTGCTGGTGG + Intergenic
1200008860 X:153106856-153106878 CAGCTCGTTACTGCCTGTGGTGG - Intergenic
1200030740 X:153293066-153293088 CAGCTCGTTACTGCCTGTGGTGG + Intergenic