ID: 1097357107

View in Genome Browser
Species Human (GRCh38)
Location 12:58614226-58614248
Sequence CTGCATGATAATGCTGTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097357107_1097357111 -2 Left 1097357107 12:58614226-58614248 CCCGAAACAGCATTATCATGCAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1097357111 12:58614247-58614269 AGGAAGAGGACCCAGTACCATGG 0: 1
1: 0
2: 0
3: 30
4: 233
1097357107_1097357116 26 Left 1097357107 12:58614226-58614248 CCCGAAACAGCATTATCATGCAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1097357116 12:58614275-58614297 AAAGCCTATTATGAGGAGAGAGG 0: 1
1: 0
2: 1
3: 19
4: 184
1097357107_1097357117 27 Left 1097357107 12:58614226-58614248 CCCGAAACAGCATTATCATGCAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1097357117 12:58614276-58614298 AAGCCTATTATGAGGAGAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 196
1097357107_1097357115 19 Left 1097357107 12:58614226-58614248 CCCGAAACAGCATTATCATGCAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1097357115 12:58614268-58614290 GGAAGAGAAAGCCTATTATGAGG 0: 1
1: 0
2: 3
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097357107 Original CRISPR CTGCATGATAATGCTGTTTC GGG (reversed) Intronic
903536922 1:24073098-24073120 CTGCATAACAATATTGTTTCAGG + Intronic
905431718 1:37929416-37929438 TTGCTTAAAAATGCTGTTTCTGG - Intronic
905709863 1:40092577-40092599 ATCCTTGATAATGCTGTTTGAGG - Intronic
907723405 1:56995598-56995620 CTGGCTGATGTTGCTGTTTCAGG - Exonic
911194611 1:94981116-94981138 CTGCATTTTATTGCTGTTTAAGG - Exonic
914049965 1:144123438-144123460 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
914129217 1:144842013-144842035 CTGCCTGCAAATGCTGTTTAGGG + Intergenic
915012958 1:152706902-152706924 CCCCATGTTAATGGTGTTTCTGG - Intergenic
915941150 1:160119236-160119258 TTGCAGGATAATGCAGTTTTGGG - Intronic
917171044 1:172174773-172174795 GTGAAGGATATTGCTGTTTCAGG + Intronic
920047098 1:203140413-203140435 GTGGATGGTGATGCTGTTTCTGG + Intronic
921451550 1:215313924-215313946 CTGAATGAAAATGCTCTTCCTGG - Intergenic
922429016 1:225528591-225528613 ATGCATTTTAATGATGTTTCTGG - Intronic
922905363 1:229169815-229169837 CTGTATGATAAAGCTCTGTCTGG - Intergenic
923992818 1:239457783-239457805 CTGCTTGATAATGCTTTTGAAGG + Intronic
1065763332 10:29003739-29003761 CTGCATGACAATGTTCTTTCTGG + Intergenic
1068577085 10:58696719-58696741 CTGTATGATTTTGCTATTTCAGG - Intronic
1076047737 10:127308045-127308067 CTGGATGACGTTGCTGTTTCTGG + Intronic
1076652868 10:132002033-132002055 GTGCCAGATAATGCTGTTACTGG - Intergenic
1080027290 11:27627917-27627939 CTGTATGATAAAACTATTTCAGG - Intergenic
1087661726 11:100996544-100996566 ATGCTTGCAAATGCTGTTTCTGG + Intergenic
1088519244 11:110677092-110677114 CTTCATTATCATGATGTTTCAGG + Intronic
1090264243 11:125344068-125344090 CAGCATGATAAAGCAGTGTCTGG - Intronic
1094190027 12:27688712-27688734 CTGCATGTTAATGTTGCTTAAGG + Intronic
1097357107 12:58614226-58614248 CTGCATGATAATGCTGTTTCGGG - Intronic
1097467581 12:59947059-59947081 CTTGATGATAATGCCATTTCTGG - Intergenic
1098163520 12:67670408-67670430 CTGCATGCCAGTGCTGTTTAAGG - Intergenic
1103384090 12:120518116-120518138 CTTTCTTATAATGCTGTTTCCGG + Intronic
1106014813 13:25858587-25858609 CTCCATCATTATGCTGTTTTAGG + Intronic
1106596927 13:31150959-31150981 ATGAATGATAAAGATGTTTCCGG - Exonic
1110934443 13:81268455-81268477 CTGCCTTATAATGCTTTTTATGG + Intergenic
1111201422 13:84942773-84942795 CTGAATGAGACTTCTGTTTCTGG + Intergenic
1112504026 13:99964238-99964260 ATGCATTAAAATGCAGTTTCAGG + Exonic
1113151459 13:107268534-107268556 CTGCAAGATAATACTGTTGGAGG + Intronic
1116682017 14:47984129-47984151 CTGTATTACAAGGCTGTTTCAGG - Intergenic
1118511020 14:66473573-66473595 TTGCATGTTAAAGCAGTTTCTGG - Intergenic
1120018580 14:79502274-79502296 ATGCATGATACTGCTGCTTAAGG - Intronic
1120525912 14:85576819-85576841 CTGAATGTCAATGCTCTTTCAGG - Intronic
1123419829 15:20122683-20122705 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
1123436560 15:20258857-20258879 CTGGGTGATAATGATGTGTCAGG + Intergenic
1123446031 15:20330849-20330871 CTGCCTGCAAATGCTGTTTAGGG + Intergenic
1123529051 15:21129219-21129241 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
1124218138 15:27826278-27826300 CTGCCTCATAATACTGTTACAGG - Intronic
1127478016 15:59352909-59352931 ATACAGGATAATGCTGTTTTCGG - Intronic
1131938884 15:97538972-97538994 CAGCATGATAAAGCAGTTCCAGG + Intergenic
1136839116 16:33524107-33524129 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
1136848009 16:33591995-33592017 CTGGGTGATAATGATGTGTCAGG - Intergenic
1137041564 16:35617369-35617391 CTGCATGGTAGTGCTTTTCCAGG - Intergenic
1138739441 16:59290834-59290856 CTGCATTCTTAAGCTGTTTCAGG - Intergenic
1203109717 16_KI270728v1_random:1440644-1440666 CTGGGTGATAATGATGTGTCAGG - Intergenic
1203149279 16_KI270728v1_random:1824394-1824416 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
1144739347 17:17572540-17572562 CTGCATGAGAATCAGGTTTCTGG + Intronic
1149184849 17:53985307-53985329 ATGCATGATAATGATGTCTGAGG - Intergenic
1159569042 18:70091066-70091088 CTGCAGAAGAATTCTGTTTCAGG + Intronic
1159788413 18:72743989-72744011 CTACATGATCATACTGTTTCAGG + Intronic
1162666900 19:12220994-12221016 CTGCATGATGCTGCTGTTGCTGG + Intergenic
1164424638 19:28130387-28130409 CTGCTTGATTATGGTGTTTGTGG + Intergenic
1165032629 19:33009256-33009278 CTGGGTGATAATGATGTGTCAGG + Intronic
1167732387 19:51268042-51268064 CAGCAGGATAATTCTGATTCTGG - Intronic
1202689354 1_KI270712v1_random:76001-76023 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
928262150 2:29777762-29777784 CTCCAAGATGATGCTATTTCTGG + Intronic
929013727 2:37473539-37473561 CTGCAGGATAATATTGTATCTGG + Intergenic
931080669 2:58766385-58766407 CTGAAAGATATTGCTGATTCTGG - Intergenic
932243376 2:70175595-70175617 GTGCATGATTATACTGCTTCTGG + Intronic
932889281 2:75577903-75577925 ATGCATGATACTGCTGCTACGGG + Intergenic
933957080 2:87380091-87380113 CTGCCTGCAAATGCTGTTTAGGG + Intergenic
934241199 2:90271982-90272004 CTGCCTGCAAATGCTGTTTAGGG + Intergenic
934271977 2:91544704-91544726 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
936147958 2:109994312-109994334 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
936196734 2:110377135-110377157 CTGCCTGCAAATGCTGTTTAGGG + Intergenic
937339280 2:121080710-121080732 CTACATCATAGTGCTGTTTGGGG - Intergenic
937795617 2:126015322-126015344 CTGAATGCTAATTCTGTTTAAGG - Intergenic
938707093 2:133941642-133941664 CAGCATGTTCATGCTGTTACTGG - Intergenic
938795159 2:134712629-134712651 CTGCCAGATAATCCTGTTTGGGG - Intronic
942519455 2:176788126-176788148 CTGCAGGATAATATTGTTCCAGG - Intergenic
948745658 2:240091475-240091497 CTGCATGATGCTGATGTTTGGGG - Intergenic
1170495359 20:16918562-16918584 CTTTCTGATAATGCTGTTTTTGG + Intergenic
1173000976 20:39105511-39105533 CAGCATGATAATGATCTGTCTGG + Intergenic
1174680011 20:52397544-52397566 CCTCATGAAAATGGTGTTTCAGG + Intergenic
1177209842 21:18057492-18057514 CTGGGTGATAATGATGTGTCAGG - Intronic
1177890446 21:26798171-26798193 CTGCAGGATGATGATGGTTCGGG - Intergenic
1181351963 22:22265446-22265468 CTGCCTGCAAATGCTGTTTAGGG - Intergenic
1182127657 22:27827973-27827995 CTGCAAAATGATGCTGTTTGGGG - Intergenic
949633409 3:5954763-5954785 TTGAATGGTAATTCTGTTTCAGG + Intergenic
950878963 3:16305808-16305830 CTACATGATAGGGCTGTTACGGG + Exonic
953083337 3:39642178-39642200 AAGCATTATAAAGCTGTTTCAGG - Intergenic
955354001 3:58215470-58215492 CTACATGACAATCCTGTTCCAGG - Intergenic
957244586 3:77701521-77701543 CTGCCTCATAATACTGTTTGGGG - Intergenic
958118060 3:89248211-89248233 CTGTATGAAAATGTTGTTCCTGG + Intronic
960811077 3:121628025-121628047 ATGGATGATACTGCTGTTTTTGG + Exonic
962373860 3:134844033-134844055 CTGAATGATGATGTTGTTACTGG + Intronic
964072382 3:152650539-152650561 CTGCATGATAAAGCTTGATCGGG - Intergenic
966776286 3:183545371-183545393 CTCCATGAAAATGTTTTTTCAGG - Intronic
971048469 4:22832057-22832079 CAGCAGGATCATGCTATTTCTGG + Intergenic
971999558 4:34013052-34013074 CTGCATGATATAGCTCTTTCTGG + Intergenic
975397544 4:73894438-73894460 ATGCTTTATCATGCTGTTTCTGG - Intergenic
977534582 4:98242133-98242155 CAGCATTAAACTGCTGTTTCTGG - Intergenic
977770903 4:100858414-100858436 TTGAATGATAATGATGTGTCAGG + Intronic
977956486 4:103033303-103033325 CAGTATGATGATGCTGTCTCTGG - Intronic
978745052 4:112183742-112183764 CAGCATGTTGATACTGTTTCTGG - Intronic
986932102 5:12838171-12838193 CTGAATGAAAATGATGTTTCTGG - Intergenic
987033809 5:14000010-14000032 ATGCATCATAATACTGTTACGGG + Intergenic
987119759 5:14755980-14756002 CTTCAGGATTATGCTGTTTCTGG + Intronic
987468489 5:18301369-18301391 CTGCATGATACTGAAGTTTGGGG + Intergenic
988072035 5:26303964-26303986 CTGCATGATCACCCTGTTCCTGG + Intergenic
988190970 5:27933832-27933854 CTGCAAAATAATGTTCTTTCAGG - Intergenic
989759174 5:44991573-44991595 GTTCATGAAAATGCTATTTCTGG - Intergenic
991040385 5:62169146-62169168 CTGGATGATTCTGCTGTTTGTGG - Intergenic
994966314 5:106676994-106677016 CTGCATGATACTGAGGTTTGGGG + Intergenic
997295303 5:132765206-132765228 CTTCATGACAATGCTGTGTCAGG + Intronic
1000971887 5:167723742-167723764 CTGCATCCTACTGCAGTTTCAGG + Intronic
1001204338 5:169748005-169748027 CTGAATGAAGAGGCTGTTTCAGG + Intronic
1001561421 5:172671702-172671724 CTGCATGTTTGGGCTGTTTCTGG + Intronic
1004055852 6:12138466-12138488 CTGCAGCATGATGCTGTGTCTGG + Intronic
1004771427 6:18786404-18786426 CTGGGTGATAATGATGTGTCAGG - Intergenic
1006535886 6:34698371-34698393 CTCCATCAGAATGCTGATTCAGG + Intergenic
1011359585 6:86509846-86509868 CTGGATGATATTGATGTTTGTGG + Intergenic
1012580355 6:100861542-100861564 CTGGATGAAAATGCTGATACTGG - Intronic
1015485642 6:133766925-133766947 ATGCATGATACCTCTGTTTCTGG - Intergenic
1016430199 6:143975476-143975498 CTGTATGCCAATGCTGTTTTAGG - Intronic
1016530032 6:145049142-145049164 CTGGATGTGAATTCTGTTTCTGG + Intergenic
1017715593 6:157209906-157209928 CTGCATAATTATGCTGTTAGTGG + Exonic
1018794673 6:167176544-167176566 CTGCAGGATCACGCTGTTCCAGG + Intronic
1018821647 6:167378523-167378545 CTGCAGGATCACGCTGTTCCAGG - Intronic
1019592613 7:1843217-1843239 CTGCAGAATGATGCTCTTTCTGG + Intronic
1020020177 7:4861795-4861817 CTGAAAGATGATGCCGTTTCCGG - Exonic
1021962187 7:25884189-25884211 CGGCAGCAGAATGCTGTTTCTGG - Intergenic
1023569342 7:41556139-41556161 CTGCATGATCATACAGTTTTGGG + Intergenic
1023571830 7:41580545-41580567 CTGGAAGATCATGGTGTTTCTGG - Intergenic
1032397269 7:131599688-131599710 CTGACTGATAATGCAGTTTTCGG - Intergenic
1032991422 7:137398825-137398847 CTGCATGCTAATAATGTTCCAGG - Intronic
1033981575 7:147171201-147171223 CTGAATGCTAAAGCTGATTCCGG - Intronic
1038144927 8:24886831-24886853 CTGCATGTTAATGTTGTCTCTGG - Intergenic
1038278075 8:26138642-26138664 CTGCATGAAAATGCTACTTATGG - Intergenic
1038795976 8:30709847-30709869 ATGCATGATCATGCTGATTATGG - Exonic
1039364719 8:36917738-36917760 CCACATGATAAAGCTGTATCAGG + Intronic
1040517086 8:48144188-48144210 CTTCATGAAAAAGCTTTTTCAGG - Intergenic
1041908964 8:63067671-63067693 CTGCATGATGCTGAGGTTTCAGG + Intronic
1042089329 8:65141673-65141695 CTCCATAAAAATGCTATTTCTGG - Intergenic
1042662836 8:71174560-71174582 TTGCATGTTAATGTTGTCTCTGG + Intergenic
1044206741 8:89499671-89499693 CTGCATGATATTGGTCTTGCAGG + Intergenic
1045398257 8:101783792-101783814 CTACAGGTTAATGCTGTTGCTGG - Intronic
1046097377 8:109577685-109577707 CTGTGTGATATGGCTGTTTCAGG - Intronic
1047395110 8:124490565-124490587 CTGTTTGATAATGCAGTTTATGG + Intronic
1048838485 8:138544081-138544103 CTGAATGACAAAGCAGTTTCTGG - Intergenic
1050060827 9:1707967-1707989 CTGCTTCATAAAGCAGTTTCAGG - Intergenic
1050290858 9:4153133-4153155 CTGCATGATATTGCTCCTTGGGG - Intronic
1057455836 9:95209379-95209401 CTGAATGATAACGATGTGTCAGG + Intronic
1059925021 9:119200749-119200771 CTGCATTGAAAGGCTGTTTCAGG - Intronic
1190227205 X:48555363-48555385 CTCCATGGGAATGCTGTTTAGGG + Intronic
1192164491 X:68818871-68818893 GTGCATGATACTGCGGTTTGGGG - Intergenic
1193443670 X:81573817-81573839 TGGCATGATAATTCTATTTCTGG - Intergenic
1194538286 X:95135950-95135972 CTGCATAATAATGCATTTTGAGG - Intergenic
1195986589 X:110637233-110637255 CTGCATGACAATGCTGCTTCTGG - Intergenic
1196869447 X:120099004-120099026 CTGCATGATAGCTCTTTTTCAGG + Intergenic
1197304029 X:124818877-124818899 CTGCATGATAAAATTGGTTCAGG + Intronic
1197652384 X:129079715-129079737 CTTCATGATAAAGCTGGTACTGG + Intergenic
1200560548 Y:4696735-4696757 CTTCCTAATTATGCTGTTTCAGG + Intergenic