ID: 1097363336

View in Genome Browser
Species Human (GRCh38)
Location 12:58682263-58682285
Sequence TTGATGTTATTGAGAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097363335_1097363336 3 Left 1097363335 12:58682237-58682259 CCAATTTTTTTTCTACTCTAACT 0: 1
1: 0
2: 9
3: 60
4: 800
Right 1097363336 12:58682263-58682285 TTGATGTTATTGAGAAAACAAGG 0: 1
1: 0
2: 3
3: 33
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097363336 Original CRISPR TTGATGTTATTGAGAAAACA AGG Intronic
904955459 1:34279947-34279969 GTGATGTTATTTGGAAAAAAAGG - Intergenic
906841899 1:49148092-49148114 TTGATGATATGAAGAAATCAAGG - Intronic
907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG + Intronic
908065764 1:60402723-60402745 TGGATGATTTTAAGAAAACAAGG - Intergenic
908087769 1:60654504-60654526 TTGATGTTTCTGAGAAAATGGGG + Intergenic
908500924 1:64743804-64743826 TTTATGTTATTCAGAACACTGGG + Intergenic
909221924 1:72975167-72975189 TTAATGTTAATGAAAAATCAAGG - Intergenic
909906664 1:81204337-81204359 TAGATGTTAGTGAGCAAATATGG - Intergenic
909957391 1:81796310-81796332 GTACTGTTAATGAGAAAACAAGG + Intronic
910943935 1:92568022-92568044 TCCATGTAAATGAGAAAACAGGG - Intronic
911690922 1:100833635-100833657 TTCAAATTATTGTGAAAACAAGG - Intergenic
913413962 1:118584231-118584253 TTCCTGTTTTTGAGAAAATAAGG + Intergenic
913499041 1:119453700-119453722 GTGATTTTAATGAGGAAACAGGG - Intergenic
913517783 1:119619012-119619034 GTGATTTTAATGAGCAAACAGGG - Intergenic
915830355 1:159123502-159123524 CTGAGGTAATAGAGAAAACAAGG - Intronic
917036199 1:170749747-170749769 ATGATGTAATGGAAAAAACATGG + Intergenic
918169378 1:181981806-181981828 CTGATGTAATAGATAAAACATGG - Intergenic
919152323 1:193717207-193717229 TTGTTGTTGTTCAGAAAACCAGG + Intergenic
919872458 1:201832576-201832598 TTGAAGTTAATGAGAAATCTGGG + Intronic
919892367 1:201984605-201984627 TTGTTGTTGTTGTTAAAACAGGG - Intronic
920203520 1:204275386-204275408 TTGATGTCATTGAGACCTCAGGG + Intronic
920330052 1:205200616-205200638 TTGATGTTATGAAGGAAAAAAGG - Intronic
920750750 1:208673533-208673555 TTCATATTAGTGAGAAAATATGG - Intergenic
922999630 1:229996341-229996363 TTCAGGTTATTGATAAAACTTGG + Intergenic
923885722 1:238152977-238152999 TTGGTGTTATGAAGAAAAGAAGG - Intergenic
924060787 1:240172092-240172114 TTGACATTCCTGAGAAAACAAGG + Intronic
1063397547 10:5704393-5704415 TTGAAATCATAGAGAAAACAGGG - Intronic
1064669831 10:17701320-17701342 TTAATGTTATTTTTAAAACATGG - Intronic
1066141690 10:32509859-32509881 TGGCTGTTATTAAGAAAAAATGG + Intronic
1066482824 10:35813352-35813374 TTGATGATTTTAAGAAGACAAGG + Intergenic
1066956788 10:42180484-42180506 TTTATGACATTGAGAAAACTAGG + Intergenic
1067841634 10:49684995-49685017 TTGATGTTTTTCAAAGAACAAGG + Intronic
1068259330 10:54557752-54557774 TTTATTTTATTAAGAAAATATGG + Intronic
1068271434 10:54731237-54731259 TTGATTTTATCAAGAAGACAAGG + Intronic
1068496164 10:57787468-57787490 TTGAAGTTATAGAAACAACAGGG - Intergenic
1069103386 10:64352376-64352398 TTTATGTTTTTTAAAAAACATGG + Intergenic
1070183310 10:74035806-74035828 TTGAAAATATTCAGAAAACAAGG + Intronic
1070360540 10:75684360-75684382 ATGGTGTTATTGGGAAAAGAAGG - Intronic
1070484996 10:76921922-76921944 TTTTTTTTATTGAGTAAACATGG - Intronic
1071457590 10:85862838-85862860 TTGATCTTCATGAGAAAATAAGG + Intronic
1072108606 10:92296914-92296936 GTGATGTGATTGAGAAAAAGAGG - Intronic
1072240573 10:93492026-93492048 TAGATGTTACTGAGCAAATAAGG - Intergenic
1073721689 10:106179985-106180007 TTGATGTCATTAAGAACAAACGG - Intergenic
1075807513 10:125200771-125200793 GTGATGATATTGTTAAAACATGG + Intergenic
1076537920 10:131194744-131194766 CTGATGCTGTTGAGAAAACAGGG - Intronic
1077724060 11:4656143-4656165 TAAATGTTGTTGAGAAATCAGGG - Intergenic
1077842312 11:5988495-5988517 TTGATGTTAGTTATAAAATAAGG - Intergenic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1079755559 11:24255739-24255761 ATAATTTTATTCAGAAAACATGG + Intergenic
1079907222 11:26263721-26263743 CTGAAGTCATTCAGAAAACATGG - Intergenic
1081290746 11:41322458-41322480 TTGAAGTTACTGAGAAAATTTGG - Intronic
1085858372 11:80202659-80202681 TTAATATTATTGAGACAACTGGG - Intergenic
1086071484 11:82804318-82804340 TTGATGATATTGAGGAATTATGG + Intergenic
1086181274 11:83955076-83955098 TTAATACTATTGAAAAAACAAGG - Intronic
1086640363 11:89147254-89147276 TTGATGTGAGTGTGAAAACTTGG + Intergenic
1087071252 11:94083162-94083184 TTAATGTTATTGTGAACCCAAGG - Intronic
1087413194 11:97818785-97818807 TTGATGGTAATAAGAAAACATGG - Intergenic
1087962380 11:104367740-104367762 TTGATTTCCTTGAGAAGACATGG + Intergenic
1088863314 11:113822118-113822140 TTTATGTTGTTGTGAAAAGATGG + Intronic
1090214195 11:124946527-124946549 CAGATGCTATTGAGAAAACTGGG + Intergenic
1090476410 11:127025593-127025615 ATGATGTTAATGAGAATAAAAGG + Intergenic
1090726992 11:129537156-129537178 TTGAAGTTATTAAAAAAAAAAGG - Intergenic
1092483962 12:8885454-8885476 TTTATTTTTTTTAGAAAACAGGG + Intronic
1093685318 12:22047307-22047329 CTGATGTTATTCATAAAAGAAGG + Intronic
1094034976 12:26059310-26059332 TTGGTGTCATTGAGAAGACAAGG + Intronic
1094397408 12:30022925-30022947 TTGATTAAATGGAGAAAACAGGG + Intergenic
1097363336 12:58682263-58682285 TTGATGTTATTGAGAAAACAAGG + Intronic
1097577434 12:61412585-61412607 TTGAAGCTGTTGAGAAAAAAGGG + Intergenic
1098267013 12:68732142-68732164 TTTATTTTCTTGAGACAACAAGG + Intronic
1098571660 12:71994655-71994677 TAAATGTTCTGGAGAAAACATGG + Intronic
1098598775 12:72304372-72304394 TTGATGTTATTTAGTAAATTTGG + Intronic
1099043384 12:77684286-77684308 TTGTTGTTATTTAGATAATATGG + Intergenic
1100227242 12:92571626-92571648 TTGATGTTAGGGAGAAAATTAGG + Intergenic
1100707817 12:97220619-97220641 GTGATTTTATTTAGAAAAAAAGG - Intergenic
1100742541 12:97609364-97609386 TTGATTTTTTTAAGAAAATAAGG - Intergenic
1101383092 12:104231423-104231445 TTTATAGTATTGAGAATACAGGG + Intronic
1101868130 12:108538321-108538343 TTGTTGTTGTTGAGGAAACCAGG - Intronic
1102079763 12:110088433-110088455 TTTAAGTTTTTGAGGAAACAAGG + Intergenic
1102101851 12:110285007-110285029 TTGATGTAACAGAAAAAACATGG + Intronic
1102838506 12:116091356-116091378 TTTAAGTTATTAAGAAAAAAAGG + Intronic
1103690442 12:122768893-122768915 TTGATGTCATTCAGGAAAAATGG + Exonic
1105542097 13:21324694-21324716 TTGATCTTATTGGGATAACATGG + Intergenic
1106167307 13:27259693-27259715 TTTATCTTATTCATAAAACATGG - Intergenic
1106962944 13:35022691-35022713 TTTATGGTATTGAGAAGACATGG + Intronic
1106997483 13:35503634-35503656 TTGCTGGTATTGAGAATTCATGG + Intronic
1108768764 13:53669468-53669490 TTGATGTGAGGTAGAAAACAAGG - Intergenic
1109069680 13:57748485-57748507 TTGATCTTAATGACAGAACACGG - Intergenic
1109314866 13:60738641-60738663 ATGCGCTTATTGAGAAAACAGGG - Intergenic
1110243388 13:73293705-73293727 ATGATGTGATTGGGAAAAAATGG - Intergenic
1110333592 13:74300845-74300867 GGGATGAGATTGAGAAAACAAGG + Intergenic
1111070167 13:83155636-83155658 TTGTTGTTATTGTGATAACTTGG - Intergenic
1111907035 13:94267089-94267111 TTGTTGTTGGTGAGAAAACGGGG - Intronic
1112390282 13:98977384-98977406 TTTATGCTATTGAGAAAATGAGG - Intronic
1113301140 13:109020601-109020623 TTGATCTTGTTAAGAAGACAAGG - Intronic
1114786223 14:25603003-25603025 TTTATATTATTGAGAAGACTGGG + Intergenic
1114917972 14:27290403-27290425 TTGATGTTATTGTTTATACATGG + Intergenic
1115450852 14:33545670-33545692 CTGAAGGAATTGAGAAAACAAGG + Intronic
1117481766 14:56152842-56152864 TTGATGTCAGTTAGAAAATATGG + Intronic
1118986129 14:70756373-70756395 ATCATGTTACTGAGAAATCATGG + Intronic
1119056471 14:71426887-71426909 TTTATGTTTTTGAGCACACAAGG - Intronic
1119862301 14:77945002-77945024 TTCATATTATTGAAAAAATAGGG - Intergenic
1120755055 14:88235082-88235104 TTGATCTGGTTCAGAAAACAGGG + Intronic
1121968665 14:98335876-98335898 TTCCTGATATTGAGAAAAGATGG + Intergenic
1121985819 14:98504529-98504551 TAGATGCTATGGAGAAACCAAGG + Intergenic
1123212808 14:106777130-106777152 TTGATGTTATAGGACAAACAAGG + Intergenic
1124503005 15:30246458-30246480 TTGGTGATATTAAGAACACAGGG + Intergenic
1124740551 15:32292188-32292210 TTGGTGATATTAAGAACACAGGG - Intergenic
1127825275 15:62697407-62697429 TAGTTGTTATTTAAAAAACAAGG - Intronic
1130308104 15:82728614-82728636 TTGAGGTGATTGACAAAAGAAGG + Intergenic
1131380333 15:91958391-91958413 TTGATGTCATGGAGCAAAGATGG + Intronic
1131687323 15:94782906-94782928 TTGATGTTATTTATAACTCAGGG - Intergenic
1133522308 16:6570963-6570985 ATAATGTTATTTTGAAAACAGGG - Intronic
1133730677 16:8576195-8576217 TGGCTGTGATTGAGAAAGCAGGG - Intronic
1133738757 16:8635460-8635482 TTGATGTCACTGAGAATAAATGG - Intronic
1139117064 16:63967840-63967862 TTGATGTTATTAAGAGAAAATGG + Intergenic
1140675155 16:77320686-77320708 GTGATGAAATTCAGAAAACAGGG + Intronic
1141029995 16:80579328-80579350 TTGAAGTTATTAAAAAAAGAAGG - Intergenic
1141761158 16:86029520-86029542 TTGGTGGAATTGAAAAAACACGG + Intergenic
1143351345 17:6290555-6290577 GTGATCTTATCGATAAAACAAGG + Intergenic
1145844574 17:28027197-28027219 GTGATGTTATATAGAAAGCATGG - Intergenic
1146433018 17:32816581-32816603 TTGAAGATATTGTTAAAACATGG - Intronic
1147892021 17:43724106-43724128 TTGATATCGTTGAGAAACCACGG - Intergenic
1148256662 17:46139418-46139440 TTGATGTTAGAGAGAAATAATGG - Intronic
1149342595 17:55701920-55701942 ATGATGCTATTAAGAAAACAAGG - Intergenic
1149885787 17:60338806-60338828 TTGAGGGGATTGAGAAAACAAGG - Intronic
1150165551 17:62938281-62938303 AAGATGTTTTTGAGAAGACAAGG + Intergenic
1150975775 17:70085038-70085060 TTCATGATACAGAGAAAACATGG - Intronic
1151172831 17:72262115-72262137 TTTATTTAGTTGAGAAAACAGGG + Intergenic
1153120697 18:1722882-1722904 TGGATGATAATGAGAACACATGG - Intergenic
1153595583 18:6721788-6721810 TTTATGTAATTGTAAAAACATGG + Intergenic
1154023944 18:10689326-10689348 GTGATGTTATAGAGAAAAGTGGG - Intronic
1155070069 18:22307261-22307283 TGGATTTTAGAGAGAAAACATGG + Intergenic
1156616552 18:38792617-38792639 TTTTTGTTATTAAGAAAAGAGGG - Intergenic
1156947701 18:42855196-42855218 TTTACGTTCTTGAGATAACAAGG + Intronic
1157083915 18:44557619-44557641 TTCAGGTTCTTGTGAAAACATGG - Intergenic
1158067604 18:53431377-53431399 TTTGTGTTATTGAGAAAATATGG + Intronic
1158300117 18:56042519-56042541 TTAATGTTAAAGAGAATACACGG - Intergenic
1159114697 18:64100915-64100937 TTTATTTTATGGAGAAAACAGGG + Intergenic
1159436903 18:68429817-68429839 AAGATGTAATGGAGAAAACAAGG + Intergenic
1160053916 18:75461950-75461972 TTGAGGTCATTGAGAAAGTAGGG + Intergenic
1160075045 18:75666755-75666777 TTGAAGATATTGGGAACACAGGG + Intergenic
1161665252 19:5572018-5572040 TTTTTGTTTTTGAGCAAACAGGG + Intergenic
1162902057 19:13800967-13800989 TTGATTTTTTTGTGAAGACAAGG - Intronic
1164955418 19:32378767-32378789 TTCATATTTTTGAGAAAACTGGG - Intronic
1165555523 19:36628487-36628509 TCAATGTTATTGTGAAAACTGGG + Exonic
1165996858 19:39849730-39849752 TTGATGGTATAGATAACACATGG + Intergenic
1166732378 19:45066417-45066439 TTGTCATTATTAAGAAAACAAGG - Intronic
926389680 2:12376058-12376080 TTATTGTTATGTAGAAAACAGGG - Intergenic
928393867 2:30929479-30929501 TTGGTGTTCCTGGGAAAACAAGG + Exonic
929388285 2:41437912-41437934 TTTAGGTTTTTCAGAAAACAAGG + Intergenic
930673129 2:54172423-54172445 TTGATGATTTGGAGAAAAGAAGG - Intronic
932052760 2:68415484-68415506 TTCATATTATTGACAAAACATGG - Intergenic
932129845 2:69177909-69177931 TTGCTGTGAATGAGAAATCAGGG - Intronic
933312441 2:80677438-80677460 TAAATGTTATTGGGGAAACAAGG + Intergenic
933425483 2:82106519-82106541 TCGATGTTATTGTGCAAACTTGG - Intergenic
934466768 2:94270321-94270343 TTGATGACATTGAGAAAAGGAGG - Intergenic
935528903 2:104208231-104208253 TATATGTTATAGAGAAAACATGG + Intergenic
936727565 2:115339287-115339309 TTGATGTCATTAAAAAAAAATGG - Intronic
937421393 2:121759224-121759246 TTGATTTTAATAAGAAAACATGG - Intronic
938518902 2:132045622-132045644 TTTATGATAAAGAGAAAACATGG + Intergenic
939902389 2:147866135-147866157 TAGAAGTGACTGAGAAAACAGGG + Intronic
940424782 2:153518036-153518058 TTTATGGTGCTGAGAAAACATGG + Intergenic
941040678 2:160619483-160619505 TTGGTGTTATTGGGAAGAAAAGG + Intergenic
941124821 2:161571966-161571988 TTGATGAAATTGAGAGAAGATGG - Intronic
941198558 2:162480622-162480644 TTGGTGGCATTCAGAAAACATGG + Intronic
941567573 2:167128066-167128088 TTTATGAAATTGATAAAACAGGG - Intronic
941620679 2:167774835-167774857 TTAATGTAATTAAGAAAACTTGG - Intergenic
941689545 2:168484973-168484995 TGGAAGTTAATGAGAAAAGAAGG + Intronic
941820156 2:169836426-169836448 TTGGTGTTAATGAGAACACATGG + Intronic
943593327 2:189825706-189825728 TGGATGTCATTGATAAAAGAAGG + Intronic
944071143 2:195670711-195670733 TAGATGTTATTGGGAAAAGTTGG + Intronic
945263666 2:207868940-207868962 TTGCTGTAAATAAGAAAACAGGG + Intronic
945596330 2:211799325-211799347 TTTATGTAATTTAGAAGACATGG - Intronic
946631871 2:221678160-221678182 TAGATGTTATTGAAAAAAAGTGG + Intergenic
1169620822 20:7504672-7504694 TTGACCTTATAGAGAAAAAAGGG + Intergenic
1170650204 20:18232422-18232444 TTGAAGTTTTTAAAAAAACAAGG - Intergenic
1171193245 20:23176666-23176688 TTGAAGATATTGTGAAAAAATGG - Intergenic
1171365492 20:24620152-24620174 TTGAGGTTTATCAGAAAACAGGG - Intronic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1174225971 20:49000397-49000419 TCAGGGTTATTGAGAAAACATGG + Intronic
1174671932 20:52316529-52316551 TTAAAGTTGTTGAGAAAAGAGGG + Intergenic
1174735063 20:52958282-52958304 TTTATTTTTTTGAGAAACCAGGG + Intergenic
1174770045 20:53291089-53291111 TTCATGTTCTTGAGGAGACATGG - Intronic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1177655614 21:24012490-24012512 TAGATGTAATTAAGAAAAAATGG - Intergenic
1178283229 21:31302583-31302605 TTGGAGTTAGTGTGAAAACATGG - Intronic
1178363589 21:31969943-31969965 TGGCTGTTTTTGAGCAAACAAGG + Intronic
1179231659 21:39509278-39509300 CTGATGTCAGTGAGAAACCACGG - Intronic
1181261944 22:21604612-21604634 GGGATGTTAATGAAAAAACATGG - Intronic
1182800335 22:33026838-33026860 CTGATGTTGTTGAGAAAACGTGG + Intronic
1182915659 22:34027315-34027337 TTGCTGTTACTGGGATAACAAGG + Intergenic
1182954144 22:34405258-34405280 TTGTAGTTATTGATATAACATGG - Intergenic
949249020 3:1960337-1960359 TTGTTGTTATTCAGACAAAAAGG - Intergenic
949701033 3:6758397-6758419 TTGAAGTTAGGAAGAAAACAAGG + Intergenic
951139549 3:19145723-19145745 TTGATGTTCATGACAACACATGG - Intergenic
953292689 3:41682205-41682227 TTGATGTATTTGATAAAACATGG - Intronic
953674515 3:44990352-44990374 TTGAACTTATTGACAAAATAAGG - Intronic
954053084 3:47998687-47998709 TGGATGTTGATGAGAAAACCGGG - Exonic
954719538 3:52549561-52549583 GTGATGTTTATGAGAAAACTAGG + Intronic
955470371 3:59280587-59280609 TTGATTTTCTAGAGAAAACATGG - Intergenic
955659025 3:61276975-61276997 TAGATGTTATTTAGATAGCATGG + Intergenic
956334091 3:68144012-68144034 TTTTTGTTTTTGAGAAAACTTGG + Intronic
957330221 3:78753737-78753759 TTGATTCTAATGAGAACACATGG - Intronic
957840735 3:85665897-85665919 TTGATCTCTTTGAGATAACAAGG + Intronic
958801110 3:98756945-98756967 TTAATTCTATTGAGAAAACAAGG - Intronic
958898425 3:99856658-99856680 GTGATGTTTTTGAAAAAATAAGG - Intronic
959325867 3:104935750-104935772 TTTATGTTATTTGGAAACCAGGG - Intergenic
959449784 3:106484887-106484909 TTGATGTGATTTATAAAACATGG + Intergenic
959914758 3:111804230-111804252 TTGTTCCTATTGAGAACACATGG + Intronic
960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG + Intergenic
962651189 3:137494059-137494081 TTGATTTGATAGACAAAACATGG - Intergenic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
964832667 3:160902617-160902639 TTGTTGTTATTGTCAAAACAAGG + Intronic
965164393 3:165176746-165176768 GTAGTGTTATTGGGAAAACATGG + Intergenic
965862121 3:173160357-173160379 TTTAAGTTCTTGAGAACACAGGG + Intergenic
965979862 3:174674675-174674697 TTGAAGTTGATGAGGAAACAGGG + Intronic
966053223 3:175648203-175648225 CTTGTGTTATTGAGAACACATGG + Intronic
966342843 3:178944713-178944735 TTGTTGTCTTTAAGAAAACAAGG - Intergenic
967675258 3:192291044-192291066 TTAATGTTATTTAATAAACAAGG - Intronic
968239139 3:197060035-197060057 TTGATATTATTGAGAATATTTGG - Intronic
969050489 4:4369547-4369569 TTGCAGTTATACAGAAAACAGGG - Intronic
969409796 4:7020427-7020449 TTGATGTTTCTGGGAATACAGGG + Intronic
969935391 4:10674915-10674937 TTCATGTTCATGAGAATACATGG + Intronic
971062157 4:22984426-22984448 TTGAAGTTCTTGAGAAAGAATGG + Intergenic
971354844 4:25886135-25886157 TCGATGTCATTGAGAACTCAAGG - Intronic
971834984 4:31750903-31750925 TTAATGTAATTAAGAATACAGGG + Intergenic
972038961 4:34566093-34566115 TTGTTGTTATGGAGATAAAAAGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973105551 4:46331891-46331913 TTGATATTTTTGGGTAAACATGG + Intronic
974728710 4:65833159-65833181 TTCATGATATTAAGAAAATAGGG + Intergenic
975052837 4:69887428-69887450 TAGAGGTTATTGAAAATACAGGG + Intergenic
975474724 4:74810528-74810550 TAGAAGTTATTTAGAAAAAAGGG - Intergenic
975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG + Intronic
976923747 4:90470975-90470997 TTGGTGATATTGATAAAAGAAGG + Intronic
977017796 4:91715271-91715293 TTGATGCCAGTGAGAAAACTAGG + Intergenic
977583963 4:98754852-98754874 TGGTTGTTATTGGGAAAAGATGG + Intergenic
977621375 4:99141514-99141536 TTTATTTTATTCAGAAAAAATGG - Intronic
978497885 4:109379510-109379532 TTGATGTCACTGAAAAAAGATGG - Intergenic
978724391 4:111953391-111953413 TTTGTGATATTCAGAAAACAAGG - Intergenic
978764537 4:112390638-112390660 TTAATGTTATTTGAAAAACATGG + Intronic
979631808 4:122910852-122910874 ATGATGTTAATGAGACAAAACGG - Intronic
980058408 4:128101405-128101427 TTTATGTTATTTTCAAAACATGG - Intronic
980289036 4:130821439-130821461 TTTATGTAATTGACAAAACTTGG - Intergenic
981449227 4:144876827-144876849 TTGCTGATATTTAAAAAACAAGG + Intergenic
982838052 4:160147775-160147797 TTGATCTTATTTAGAAATCCAGG + Intergenic
983148793 4:164250470-164250492 TTGATCTTATTGTGTAAACTGGG + Intronic
983320957 4:166195745-166195767 TGGATGTTATTAAGAAAATTTGG + Intergenic
983379438 4:166972429-166972451 TTGATGTGCTTGTCAAAACAGGG - Intronic
983403504 4:167295611-167295633 TTGATTCAATTGAGAAAACAAGG - Intergenic
984341979 4:178469093-178469115 TTGAAGTTATTGACATATCAGGG - Intergenic
984395760 4:179197523-179197545 TTGTTGTTATTAAGAAAACAAGG + Intergenic
986020086 5:3793732-3793754 TTCAAATTATTGAGAATACAAGG + Intergenic
986641931 5:9880483-9880505 GTGTTGATATTGAGAAACCATGG - Intergenic
986825622 5:11519069-11519091 ATGATGTTAGGGAGAACACATGG - Intronic
988021193 5:25624745-25624767 TTGATGTTATCAAGAAATAAAGG - Intergenic
988044604 5:25934083-25934105 TTGATGTTATGGTTAAAAGAAGG - Intergenic
988101025 5:26678861-26678883 ATGATTTTCTTGTGAAAACATGG - Intergenic
989018942 5:36977454-36977476 TTAATGTTATTGAAAAAAAATGG + Intronic
990076956 5:51858244-51858266 TAAATGTAATTGAGAAAAAAAGG + Intergenic
993015824 5:82533409-82533431 ATCATGTTCTGGAGAAAACAGGG + Intergenic
993342669 5:86743326-86743348 ATGATGCTATGGAGAAACCAAGG - Intergenic
993355877 5:86906679-86906701 TTGAAGTTATTGAGAAAACTAGG - Intergenic
993408808 5:87548444-87548466 ATTATGTTATTCTGAAAACAGGG + Intergenic
993524461 5:88946967-88946989 TTGATCTTAATAAGAAAACTAGG - Intergenic
993748660 5:91636759-91636781 TCCATGTTAATGAGAAACCAAGG - Intergenic
996040805 5:118808689-118808711 TTGATTATCCTGAGAAAACAGGG - Intergenic
998336925 5:141381478-141381500 CTAGTGTAATTGAGAAAACAGGG - Intronic
998774255 5:145581278-145581300 GTGATGATATTGACAACACATGG - Intronic
998831456 5:146163906-146163928 TTGTTGTTTATTAGAAAACAGGG + Intronic
999003624 5:147951667-147951689 ATGCTGTTATTGTGACAACAAGG - Intergenic
1000855842 5:166396892-166396914 TTGATGTTTATGTGAAAATATGG + Intergenic
1001073728 5:168608297-168608319 TTTTTGTTTTTGAAAAAACAAGG + Intergenic
1003605622 6:7557970-7557992 ATGATCTTATTGAGATAAGAAGG - Intronic
1003766727 6:9245399-9245421 TTTATGTCCTTGGGAAAACAAGG + Intergenic
1003804693 6:9713911-9713933 TTCATGTTACTGTGACAACAAGG - Intronic
1003928314 6:10898172-10898194 TTCAAGTTATTTATAAAACATGG + Intronic
1004009522 6:11668914-11668936 TTGCTTTTATTCAGAAAACCTGG + Intergenic
1004341024 6:14807490-14807512 TTGAGGTTATTGAGAGCACCAGG - Intergenic
1004630940 6:17420524-17420546 TTTATGTAATTGAGTAAACAAGG + Intronic
1005226232 6:23645780-23645802 ATGAAGTTATTTGGAAAACAAGG + Intergenic
1005693677 6:28331781-28331803 TTAATGCTATTGAGAAACCATGG + Intronic
1005862562 6:29912698-29912720 TTGATGATAAAGAGAAAAAAAGG - Intergenic
1006190921 6:32208429-32208451 TGGCTGTTATTGAAAACACAAGG + Intronic
1006885401 6:37377633-37377655 TTGTTGTTGAGGAGAAAACAGGG + Intronic
1007638372 6:43315312-43315334 TTGAGGATACTGAGAAATCATGG - Intronic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1008837047 6:55846350-55846372 TTGGTGTTATTGAAGACACATGG + Intronic
1009720723 6:67465896-67465918 GTGGGGTTATTGAGAAAAAAAGG + Intergenic
1009791669 6:68409455-68409477 TTGAAGTTATTGCAAAAATATGG + Intergenic
1012713170 6:102634179-102634201 TAGAGGTTATTTATAAAACAAGG + Intergenic
1012813308 6:103988805-103988827 TTTATGTTGTTTATAAAACATGG - Intergenic
1013395524 6:109734826-109734848 TTGATGGTCTTGTGCAAACAGGG - Intronic
1013535592 6:111060504-111060526 TTGTTGTTTTTTAGGAAACAGGG - Intergenic
1013830250 6:114263929-114263951 TTTATGTGATTGAGATACCATGG - Intronic
1014943368 6:127469619-127469641 TTGAAGTTATAGGGAAAAGATGG + Intronic
1019097790 6:169599189-169599211 TTATTGTTTTTGAGAACACATGG - Intronic
1020484170 7:8700801-8700823 TTTCTGTAATAGAGAAAACATGG - Intronic
1020835234 7:13141280-13141302 TTGATGATAGTGAAAAAAAAAGG - Intergenic
1021154346 7:17191853-17191875 TTGGTGTTATTGAGATCTCAAGG - Intergenic
1021748901 7:23775053-23775075 TAAATGTTATTGGGAAAACTGGG - Intronic
1022041730 7:26588039-26588061 TTCATGGTATTGAGAAGAAAGGG + Intergenic
1022050531 7:26664379-26664401 TTGATGTGATAAAGAACACAAGG + Intergenic
1022322365 7:29299023-29299045 TTGAATTTATTGGGAAAAAAGGG + Intronic
1022658850 7:32347306-32347328 TTGATTTTTTTGAGGAATCAAGG + Intergenic
1023018411 7:35987768-35987790 TTGATGTTCTTGACATAAAATGG + Intergenic
1023958465 7:44907007-44907029 TTTACATTATTGAGAAAACATGG + Intergenic
1026851706 7:73728068-73728090 ATGATGTGTTTGAGAAAACTAGG - Intergenic
1027492475 7:78846542-78846564 TTGATGTTACCAAGAGAACAAGG + Intronic
1027688713 7:81312922-81312944 TTAATGTAATTGTGACAACATGG + Intergenic
1027999541 7:85475137-85475159 TTGAGGTCATTGCCAAAACATGG - Intergenic
1028033924 7:85955271-85955293 TTTATGAGATTGAGAAAACAGGG - Intergenic
1029931669 7:104377822-104377844 TTATTATTATTGAGAATACATGG - Intronic
1030942164 7:115666303-115666325 TTGTTTTGATGGAGAAAACATGG + Intergenic
1031415761 7:121494990-121495012 TTGATGTTTCTGGGTAAACAGGG - Intergenic
1031467617 7:122133002-122133024 TTGTGGTTATGTAGAAAACATGG + Intronic
1034310864 7:150086526-150086548 TTAATGTGTTTGAGAAAGCAGGG - Intergenic
1034506360 7:151495092-151495114 ATGAAGTTATTGAGAGAAAAAGG - Intronic
1034795982 7:154014108-154014130 TTAATGTGTTTGAGAAAGCAGGG + Intronic
1037465911 8:19160565-19160587 TTGATGTTGTTCATAAAACAGGG + Intergenic
1037806090 8:22058599-22058621 TTGTTGTTATTGAGAGAACAAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041160892 8:55043131-55043153 TTGATGCTTTTGTGAAAATAAGG - Intergenic
1041587792 8:59542105-59542127 TTCATGATATTGAGAGAATATGG - Intergenic
1042395668 8:68289195-68289217 ATTTTGTTATAGAGAAAACAAGG + Intergenic
1042503912 8:69539299-69539321 ATGATCTTTTTGAGAAACCAGGG + Intronic
1042575520 8:70214235-70214257 TTGATTTTTTTAAAAAAACATGG - Intronic
1042694649 8:71543475-71543497 TTGATGGTACTGGGAAAAAAAGG - Intronic
1042804091 8:72753192-72753214 TTAATGTTCTGAAGAAAACATGG - Intronic
1043733540 8:83715978-83716000 TTCATGTTAAAAAGAAAACAGGG + Intergenic
1044757491 8:95480224-95480246 GGGATGTTATTCAAAAAACAAGG - Intergenic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1046828042 8:118713535-118713557 TTTTTATTATTGAGAAAACATGG - Intergenic
1047884087 8:129228856-129228878 TTGATGATATTGTGAAGATAAGG - Intergenic
1049981082 9:904445-904467 ATTATGGTATTGAAAAAACAGGG - Intronic
1050183060 9:2941355-2941377 ATGATGGTGTTGAGAAAACGAGG + Intergenic
1050291727 9:4162214-4162236 TTGATGTTCTTAAAAAAAGAAGG - Intronic
1050772391 9:9218426-9218448 TTTATGTTACTGAGAAAAAGAGG - Intronic
1050876714 9:10648236-10648258 TTGATGTTTTTGAGAATAAAAGG + Intergenic
1050977083 9:11952471-11952493 TTGAAGTTAATCAGATAACATGG - Intergenic
1052376659 9:27725351-27725373 TTTGTGGTATTGAGAACACAAGG + Intergenic
1052749063 9:32470155-32470177 TTGGTTTTACTGAGAATACATGG - Intronic
1053087680 9:35240753-35240775 TTGATTTTATTTAAAAATCAGGG + Intronic
1053582053 9:39415250-39415272 TTGATCTTATTGAGCATTCAAGG - Intergenic
1053846469 9:42242573-42242595 TTGATCTTATTGAGCATTCAAGG - Intergenic
1054103631 9:60973989-60974011 TTGATCTTATTGAGCATTCAAGG - Intergenic
1054352216 9:64027682-64027704 GTGATGTTATTGAGATGACTGGG - Intergenic
1054582720 9:66932862-66932884 TTGATCTTATTGAGCATTCAAGG + Intergenic
1055189871 9:73504962-73504984 TTGTTGTTACTGAAAAACCAGGG - Intergenic
1055240933 9:74184867-74184889 TATATGTTATTCAGAAAACTTGG + Intergenic
1056856379 9:90133177-90133199 TTGGGGTGATTGAGCAAACATGG - Intergenic
1057029189 9:91760790-91760812 TTCATGATATTGAGAAAGCATGG + Intronic
1058311256 9:103505765-103505787 TTTATGATAATGTGAAAACAAGG - Intergenic
1058387386 9:104453731-104453753 TTGATGTTTTTAATAAATCAAGG - Intergenic
1058609580 9:106761032-106761054 TTGAAGTTATTGTGGAAAAATGG - Intergenic
1060905379 9:127300141-127300163 TTGATGTTATTCAGGAAAACTGG - Intronic
1185915489 X:4029874-4029896 TTAAAGTTATTGAGAAAATGTGG + Intergenic
1187320833 X:18236318-18236340 TAGATGTTAATGTGAAAAGATGG - Intergenic
1187742741 X:22373899-22373921 TTCCTGTTCTTGAGTAAACATGG - Intergenic
1188638237 X:32463134-32463156 TTTATGTTCTGAAGAAAACATGG + Intronic
1189120642 X:38390768-38390790 TGGATGTTGATGAGCAAACATGG - Intronic
1189984869 X:46545061-46545083 TTCATGTTATAGAGAGAAAACGG - Intronic
1190803748 X:53815203-53815225 AAAATGTTATTGAGAAAACTGGG + Intergenic
1192345372 X:70299220-70299242 TTGATGTTATTAAAAAAATTTGG + Intronic
1193092262 X:77507385-77507407 TTGATGTTGTTTATAAAACAGGG + Exonic
1193781214 X:85703516-85703538 TGGAAGTTAATGAGAACACATGG + Intergenic
1194053165 X:89098069-89098091 TTTATGTTTTTTAAAAAACATGG - Intergenic
1194270921 X:91814239-91814261 TGAATGTTTTTGATAAAACAGGG - Intronic
1194486184 X:94490149-94490171 AAGATTTTATTAAGAAAACAGGG + Intergenic
1195110593 X:101645163-101645185 ATGTTTTTATTGAGAACACAGGG + Intergenic
1197473022 X:126885870-126885892 TTGATTTTATTGACATAAAATGG - Intergenic
1198173123 X:134127375-134127397 TCAATGTTCATGAGAAAACATGG - Intergenic
1198337529 X:135681266-135681288 CTGATGTTTTTCAGCAAACAAGG - Intergenic
1199145105 X:144356215-144356237 TTGTTGTGTTTCAGAAAACAGGG + Intergenic
1199507517 X:148582016-148582038 TTGATATTTTTGAAAATACAGGG + Intronic
1200588162 Y:5035674-5035696 TGAATGTTTTTGATAAAACAGGG - Intronic