ID: 1097367303

View in Genome Browser
Species Human (GRCh38)
Location 12:58731311-58731333
Sequence GGCTTAAGGGCCCCATGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097367303_1097367307 7 Left 1097367303 12:58731311-58731333 CCAGATCATGGGGCCCTTAAGCC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1097367307 12:58731341-58731363 TGACTTTTACTGAGTGAGCTAGG 0: 1
1: 0
2: 1
3: 27
4: 182
1097367303_1097367311 19 Left 1097367303 12:58731311-58731333 CCAGATCATGGGGCCCTTAAGCC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1097367311 12:58731353-58731375 AGTGAGCTAGGATGCCATGGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
1097367303_1097367313 21 Left 1097367303 12:58731311-58731333 CCAGATCATGGGGCCCTTAAGCC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1097367313 12:58731355-58731377 TGAGCTAGGATGCCATGGGGGGG 0: 1
1: 0
2: 2
3: 15
4: 149
1097367303_1097367308 16 Left 1097367303 12:58731311-58731333 CCAGATCATGGGGCCCTTAAGCC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1097367308 12:58731350-58731372 CTGAGTGAGCTAGGATGCCATGG 0: 1
1: 0
2: 2
3: 21
4: 173
1097367303_1097367310 18 Left 1097367303 12:58731311-58731333 CCAGATCATGGGGCCCTTAAGCC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1097367310 12:58731352-58731374 GAGTGAGCTAGGATGCCATGGGG 0: 1
1: 0
2: 0
3: 12
4: 166
1097367303_1097367312 20 Left 1097367303 12:58731311-58731333 CCAGATCATGGGGCCCTTAAGCC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1097367312 12:58731354-58731376 GTGAGCTAGGATGCCATGGGGGG 0: 1
1: 0
2: 2
3: 13
4: 128
1097367303_1097367309 17 Left 1097367303 12:58731311-58731333 CCAGATCATGGGGCCCTTAAGCC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1097367309 12:58731351-58731373 TGAGTGAGCTAGGATGCCATGGG 0: 1
1: 0
2: 3
3: 29
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097367303 Original CRISPR GGCTTAAGGGCCCCATGATC TGG (reversed) Intronic
900633584 1:3651432-3651454 TGCTTATGGGGCCCGTGATCTGG - Intronic
900800127 1:4732161-4732183 GCCCGAAGGGCCCCATGATGTGG + Intronic
903153919 1:21431190-21431212 GGCATAAGGGCCCCACCCTCAGG + Intergenic
905461265 1:38124318-38124340 GGCCCACGGGCCCCATCATCTGG + Intergenic
911040650 1:93588505-93588527 GCATTAAGGCCCCCATGATCTGG + Intronic
1067497388 10:46773337-46773359 GGCTGAGGGGCTCCATGAGCAGG - Intergenic
1067597263 10:47567078-47567100 GGCTGAGGGGCTCCATGAGCAGG + Intergenic
1071604560 10:86976146-86976168 GGCTGCAGGGAGCCATGATCAGG - Intronic
1074385585 10:113014290-113014312 GGCTTCAGGGACCCATGAGAAGG + Intronic
1075727987 10:124620395-124620417 CGCTTTAGGACCCCATGAGCAGG + Exonic
1076236208 10:128865229-128865251 CGCTCAAGGCCCCCATGACCGGG + Intergenic
1076996120 11:298354-298376 GGCTGGAGGGCCCCAGGATCAGG + Exonic
1077131668 11:976052-976074 GGCTTCAGGACCCCATGACTGGG - Intronic
1083920756 11:65780576-65780598 GGCTCAGGGGCCCCATGGTGAGG + Exonic
1084407100 11:68980413-68980435 GGGTTAAGACCCCCATGATGAGG + Exonic
1085961298 11:81465743-81465765 GGCATAAGGGCCACTTGAACTGG + Intergenic
1087038263 11:93774538-93774560 GGCTAAAGTGAGCCATGATCAGG + Intronic
1089014520 11:115155403-115155425 GGCTGCAGGGCCCCAGGCTCGGG + Intergenic
1092219636 12:6703987-6704009 GGCTTAAGGGGCCCAGGAGGTGG - Intergenic
1097367303 12:58731311-58731333 GGCTTAAGGGCCCCATGATCTGG - Intronic
1097918716 12:65048185-65048207 GGCTTAAGGGCTACGTTATCTGG + Intergenic
1100427422 12:94500297-94500319 GGCTTTAGTGAGCCATGATCAGG + Intergenic
1101150424 12:101877936-101877958 GGCGTCAGGGCCCCAGGAGCAGG + Intronic
1101246883 12:102891911-102891933 GGCTGAATTGCCCCAGGATCTGG + Intronic
1103078753 12:118006457-118006479 GGCTACAGGGAGCCATGATCAGG + Intergenic
1104517989 12:129445654-129445676 GGCTTAATGAACCCATGACCTGG - Intronic
1112206627 13:97330255-97330277 GGCTTATGTGACCCATGAGCTGG + Intronic
1114476321 14:22997609-22997631 TGCTTAAGGGCCATATGAGCAGG - Intronic
1115776389 14:36720008-36720030 GGCTACAGGGGCCCTTGATCTGG + Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1118983209 14:70732601-70732623 GGCTTAAGGGCCCCATCAGAAGG + Exonic
1119767455 14:77199386-77199408 AGATTCAGGGCCTCATGATCTGG + Intronic
1122396845 14:101439661-101439683 GGCTTCAGGCACCGATGATCTGG - Intergenic
1128350842 15:66887310-66887332 TGCTTATAGGCACCATGATCTGG + Intergenic
1129328551 15:74815121-74815143 GGCTGAAGGAGCCCATGGTCTGG + Intronic
1129619597 15:77132141-77132163 GGCTGAAGTGAGCCATGATCGGG - Intronic
1135854746 16:25997757-25997779 GGATCAAGTGCCCCATGCTCTGG + Intronic
1136341903 16:29649598-29649620 GGATTCAGGGCCCCTTGATCAGG + Intergenic
1139141288 16:64265913-64265935 GGTTAATGGGCCACATGATCTGG - Intergenic
1142339258 16:89509849-89509871 GGCTTCAGGGAGCCATGATCAGG - Intronic
1143112011 17:4558218-4558240 GGCTTCAGGGACCCCTGATGTGG - Exonic
934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG + Intronic
934770743 2:96906496-96906518 GGCTGAAGGGGCCCAGGGTCAGG - Intronic
935359532 2:102235744-102235766 GTCTTCAGGGCCCCATGCTCAGG + Intronic
937953035 2:127402783-127402805 AGCTTAAGGCCTCCATAATCAGG + Intergenic
938062902 2:128266485-128266507 GGCATAAGGGCCCCACCCTCAGG - Exonic
946301005 2:218824053-218824075 GGCATAAGGGCCCCATGGACAGG + Intronic
1179883633 21:44304244-44304266 GGCAAAGGGGCCCCAGGATCAGG - Intronic
1182774185 22:32818856-32818878 GGCTTCAGAGCCCCATGACAGGG - Intronic
1183667782 22:39255191-39255213 GGCTGCTGGGCCCCATGGTCAGG + Intergenic
952886056 3:38011493-38011515 GGGTCAAGGGCCCCATGGACAGG + Intronic
954435480 3:50493733-50493755 TCCTCAAGGGCCCCATGACCCGG + Intronic
956247767 3:67203363-67203385 GGGTTGAGGGCCCCAGGCTCTGG - Intergenic
961473922 3:127135461-127135483 GGCTCAAGGGCCCCCTGCGCTGG - Intergenic
962856969 3:139355742-139355764 GGCTCAAGGGGCCAAGGATCAGG + Exonic
966637010 3:182146644-182146666 GGCTTAAGGGGACAAGGATCTGG - Intergenic
971245174 4:24920855-24920877 GGCTTAAGTGACCCCTGAACTGG - Intronic
1000469554 5:161623371-161623393 GGCTGCAGGGAGCCATGATCAGG + Intronic
1005000464 6:21235062-21235084 GGCTGAAGGCCCCCAAGCTCAGG - Intergenic
1006083808 6:31582264-31582286 GGCCTTAGTGCCCCAGGATCAGG - Exonic
1010202152 6:73291668-73291690 TGCTAAAGGGTCCCAAGATCAGG + Intronic
1013093589 6:106923014-106923036 GGCTGCAGTGCACCATGATCAGG + Intergenic
1017450161 6:154547797-154547819 GGCTTCAGTGAGCCATGATCGGG - Intergenic
1019172099 6:170138354-170138376 TGCTCCAGGGCCCCAGGATCGGG + Intergenic
1020853565 7:13388997-13389019 GGCTCAGGGGCACCATGATCAGG - Intergenic
1031083903 7:117283431-117283453 GGCTTAAGGGGGCCAGGATAAGG + Intronic
1033116009 7:138626192-138626214 TGCTTAAGGACCCCACAATCAGG - Intronic
1034166153 7:149026734-149026756 GGCTTAAGTAAGCCATGATCAGG + Intronic
1035373043 7:158391509-158391531 GGCTTAAGGTCACCATGAGGAGG + Intronic
1041084895 8:54247699-54247721 GGCCTAGGGGTCCCATGGTCCGG - Intergenic
1044814974 8:96102591-96102613 GTTTTAGGGGTCCCATGATCTGG + Intergenic
1046127999 8:109935007-109935029 GGCTGCAGTGCCCTATGATCTGG - Intergenic
1047529193 8:125659792-125659814 GGCTTAAGGACCTCAAGCTCCGG - Intergenic
1048132516 8:131713541-131713563 AGCTTTGGGTCCCCATGATCTGG - Intergenic
1060435079 9:123586243-123586265 GGCTGAATGGCCCCATGAATGGG + Intronic
1203785295 EBV:124257-124279 AGCTCGAGGGCCCCATAATCTGG + Intergenic
1203492350 Un_GL000224v1:119025-119047 GGCTAAGGGGCCACCTGATCTGG - Intergenic
1203504973 Un_KI270741v1:60897-60919 GGCTAAGGGGCCACCTGATCTGG - Intergenic
1190275393 X:48896087-48896109 GGCTGTAGTGACCCATGATCAGG + Intronic
1192849209 X:74936281-74936303 GGCTTGAGTGCCCCAAGATCAGG - Intergenic
1195968392 X:110449636-110449658 GCTTTAAGTGACCCATGATCTGG + Intronic
1200938561 Y:8759641-8759663 GGCTTAAGGATCCCTGGATCTGG - Intergenic
1202255307 Y:22914457-22914479 GGCTAAAGAGCCACATCATCTGG - Intergenic
1202408298 Y:24548206-24548228 GGCTAAAGAGCCACATCATCTGG - Intergenic
1202462484 Y:25121874-25121896 GGCTAAAGAGCCACATCATCTGG + Intergenic