ID: 1097376748

View in Genome Browser
Species Human (GRCh38)
Location 12:58852228-58852250
Sequence CAGCAAACAGCAGTGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097376740_1097376748 23 Left 1097376740 12:58852182-58852204 CCTGCTGGATCTGGAGGGATGGA No data
Right 1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG No data
1097376738_1097376748 24 Left 1097376738 12:58852181-58852203 CCCTGCTGGATCTGGAGGGATGG No data
Right 1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097376748 Original CRISPR CAGCAAACAGCAGTGGTGGG CGG Intergenic
No off target data available for this crispr