ID: 1097377757

View in Genome Browser
Species Human (GRCh38)
Location 12:58859357-58859379
Sequence CAGCAAACAGCAGTGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097377746_1097377757 24 Left 1097377746 12:58859310-58859332 CCCTGCTGGATCTGGAGGGATGG No data
Right 1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG No data
1097377748_1097377757 23 Left 1097377748 12:58859311-58859333 CCTGCTGGATCTGGAGGGATGGA No data
Right 1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097377757 Original CRISPR CAGCAAACAGCAGTGGTGGG CGG Intergenic
No off target data available for this crispr